Incidental Mutation 'R0966:Cd101'
ID84049
Institutional Source Beutler Lab
Gene Symbol Cd101
Ensembl Gene ENSMUSG00000086564
Gene NameCD101 antigen
SynonymsIgsf2, LOC381460
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100993529-101029556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101008222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 676 (S676R)
Ref Sequence ENSEMBL: ENSMUSP00000126027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147399] [ENSMUST00000167086]
Predicted Effect probably benign
Transcript: ENSMUST00000147399
AA Change: S680R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116643
Gene: ENSMUSG00000086564
AA Change: S680R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 28 143 4.96e-8 SMART
IG 153 266 4.74e-5 SMART
IG_like 274 379 2.19e-1 SMART
IG 289 395 3.25e-3 SMART
IG 417 533 4.85e-11 SMART
IG 545 659 1.52e-3 SMART
IG 680 805 3.16e-1 SMART
IG_like 827 927 2.95e-1 SMART
IG 856 955 1.04e-1 SMART
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167086
AA Change: S676R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126027
Gene: ENSMUSG00000086564
AA Change: S676R

DomainStartEndE-ValueType
IG 24 139 4.96e-8 SMART
IG 149 262 4.74e-5 SMART
IG_like 270 375 2.19e-1 SMART
IG 285 391 3.25e-3 SMART
IG 413 529 4.85e-11 SMART
IG 541 655 1.52e-3 SMART
IG 676 801 3.16e-1 SMART
IG_like 823 923 2.95e-1 SMART
IG 852 951 1.04e-1 SMART
transmembrane domain 967 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Gr-1+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Cd101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cd101 APN 3 101003702 missense probably damaging 1.00
IGL01443:Cd101 APN 3 101003571 missense probably benign
IGL02000:Cd101 APN 3 101012082 missense probably benign 0.11
IGL02178:Cd101 APN 3 100993766 missense probably damaging 1.00
IGL02224:Cd101 APN 3 101017002 missense probably benign
IGL02450:Cd101 APN 3 100993738 missense probably damaging 0.99
IGL02502:Cd101 APN 3 101011825 missense probably damaging 0.99
IGL02536:Cd101 APN 3 101003597 missense probably damaging 1.00
IGL02749:Cd101 APN 3 101020399 missense probably damaging 1.00
IGL02818:Cd101 APN 3 101011929 missense probably damaging 1.00
IGL02829:Cd101 APN 3 101018565 splice site probably benign
IGL02902:Cd101 APN 3 101018994 splice site probably benign
tax_day UTSW 3 101003705 missense possibly damaging 0.86
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0411:Cd101 UTSW 3 101018527 intron probably null
R0486:Cd101 UTSW 3 101008092 missense possibly damaging 0.94
R0556:Cd101 UTSW 3 101020654 missense probably damaging 1.00
R0726:Cd101 UTSW 3 101020622 missense possibly damaging 0.95
R1344:Cd101 UTSW 3 101018775 nonsense probably null
R1418:Cd101 UTSW 3 101018775 nonsense probably null
R1547:Cd101 UTSW 3 101018951 missense possibly damaging 0.94
R1551:Cd101 UTSW 3 101012013 missense probably damaging 0.99
R1845:Cd101 UTSW 3 101029448 splice site probably null
R1919:Cd101 UTSW 3 101018917 missense probably damaging 1.00
R1976:Cd101 UTSW 3 101008061 missense probably damaging 0.96
R2260:Cd101 UTSW 3 101016945 missense possibly damaging 0.82
R2679:Cd101 UTSW 3 100993763 missense probably benign 0.00
R2873:Cd101 UTSW 3 101003848 missense probably benign 0.00
R3606:Cd101 UTSW 3 101020597 missense probably damaging 1.00
R4201:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4202:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4205:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4349:Cd101 UTSW 3 101013314 missense possibly damaging 0.93
R4574:Cd101 UTSW 3 101013153 missense probably benign 0.02
R4601:Cd101 UTSW 3 100993888 missense possibly damaging 0.84
R4820:Cd101 UTSW 3 101022155 missense probably benign 0.01
R4910:Cd101 UTSW 3 100993889 missense probably benign 0.13
R5014:Cd101 UTSW 3 101003823 missense probably damaging 0.99
R5081:Cd101 UTSW 3 101003705 missense possibly damaging 0.86
R5396:Cd101 UTSW 3 101018810 missense probably damaging 1.00
R5425:Cd101 UTSW 3 101018686 missense probably damaging 1.00
R6193:Cd101 UTSW 3 101020462 missense probably damaging 1.00
R6210:Cd101 UTSW 3 101018643 missense probably damaging 1.00
R6732:Cd101 UTSW 3 101008199 missense probably benign 0.01
R6830:Cd101 UTSW 3 100993696 missense probably benign 0.12
R6897:Cd101 UTSW 3 101013060 missense probably damaging 1.00
R6940:Cd101 UTSW 3 101003702 missense probably damaging 1.00
R7335:Cd101 UTSW 3 101018729 missense probably benign 0.01
R7565:Cd101 UTSW 3 101018792 missense probably benign 0.00
R7880:Cd101 UTSW 3 101007866 missense probably benign 0.00
R7963:Cd101 UTSW 3 101007866 missense probably benign 0.00
R8121:Cd101 UTSW 3 101020582 missense probably damaging 1.00
X0018:Cd101 UTSW 3 101018632 missense possibly damaging 0.95
X0023:Cd101 UTSW 3 101018855 missense probably benign
X0058:Cd101 UTSW 3 101020421 missense probably damaging 1.00
Z1177:Cd101 UTSW 3 101011916 missense probably benign 0.03
Z1177:Cd101 UTSW 3 101017140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCACTGTCCTCCACACTCAGAATG -3'
(R):5'- GGTTGTAGAGCAGCAGTTCTCAACTTG -3'

Sequencing Primer
(F):5'- CCGAGGGGTTTGAAATTCGTC -3'
(R):5'- ggtcaccaccacaacatgag -3'
Posted On2013-11-08