Incidental Mutation 'R0966:Ugt2b38'
ID84051
Institutional Source Beutler Lab
Gene Symbol Ugt2b38
Ensembl Gene ENSMUSG00000061906
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87409942-87424203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87412373 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 361 (N361H)
Ref Sequence ENSEMBL: ENSMUSP00000072598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072818]
Predicted Effect probably damaging
Transcript: ENSMUST00000072818
AA Change: N361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: N361H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 4.1e-255 PFAM
Pfam:Glyco_tran_28_C 330 444 1.2e-7 PFAM
Meta Mutation Damage Score 0.8618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Ugt2b38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ugt2b38 APN 5 87411823 missense probably damaging 1.00
IGL02326:Ugt2b38 APN 5 87423733 missense probably damaging 1.00
IGL02537:Ugt2b38 APN 5 87421731 missense possibly damaging 0.91
IGL02543:Ugt2b38 APN 5 87423483 missense probably benign 0.00
IGL02852:Ugt2b38 APN 5 87411741 missense probably benign
IGL03008:Ugt2b38 APN 5 87412423 missense probably benign 0.00
over_easy UTSW 5 87423742 missense probably benign 0.25
R0089:Ugt2b38 UTSW 5 87420558 missense probably benign 0.00
R0647:Ugt2b38 UTSW 5 87423469 missense probably benign 0.00
R0731:Ugt2b38 UTSW 5 87420452 missense probably damaging 1.00
R0837:Ugt2b38 UTSW 5 87411773 missense probably damaging 1.00
R0969:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0970:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0971:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1068:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1070:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1071:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1073:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1133:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1134:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1367:Ugt2b38 UTSW 5 87424114 missense probably benign 0.11
R1383:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1565:Ugt2b38 UTSW 5 87411914 missense probably damaging 0.99
R1691:Ugt2b38 UTSW 5 87424132 missense probably benign
R1725:Ugt2b38 UTSW 5 87411871 missense probably damaging 1.00
R1736:Ugt2b38 UTSW 5 87423633 missense probably benign
R2230:Ugt2b38 UTSW 5 87421668 missense probably benign 0.05
R2419:Ugt2b38 UTSW 5 87423732 missense probably damaging 1.00
R2496:Ugt2b38 UTSW 5 87421692 missense probably damaging 1.00
R3196:Ugt2b38 UTSW 5 87410219 missense probably damaging 0.96
R3773:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R5125:Ugt2b38 UTSW 5 87411812 missense probably damaging 1.00
R5224:Ugt2b38 UTSW 5 87423742 missense probably benign 0.25
R5516:Ugt2b38 UTSW 5 87411843 missense probably damaging 1.00
R5765:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R6352:Ugt2b38 UTSW 5 87424001 missense possibly damaging 0.73
R7166:Ugt2b38 UTSW 5 87410446 missense probably damaging 1.00
R7210:Ugt2b38 UTSW 5 87410425 missense probably damaging 0.99
R7291:Ugt2b38 UTSW 5 87411895 missense probably damaging 1.00
R7483:Ugt2b38 UTSW 5 87424114 missense probably damaging 0.96
R7969:Ugt2b38 UTSW 5 87424032 missense probably benign 0.02
R8118:Ugt2b38 UTSW 5 87423771 missense probably damaging 1.00
R8239:Ugt2b38 UTSW 5 87423800 missense probably benign 0.02
R8676:Ugt2b38 UTSW 5 87411822 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTGGCCCCACCATGAGTTACAAAG -3'
(R):5'- GGCACACTCGTTGCTCAGTCTT -3'

Sequencing Primer
(F):5'- CTCTGTCTCAGAGCTAGAAGAATC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-11-08