Incidental Mutation 'R0966:Vps36'
ID84057
Institutional Source Beutler Lab
Gene Symbol Vps36
Ensembl Gene ENSMUSG00000031479
Gene Namevacuolar protein sorting 36
SynonymsEap45, 2810408E15Rik, 1700010A24Rik, 2210415M20Rik
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22192809-22220843 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 22206817 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 131 (W131*)
Ref Sequence ENSEMBL: ENSMUSP00000033866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033866]
PDB Structure The complex structure between the mouse EAP45-GLUE domain and ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033866
AA Change: W131*
SMART Domains Protein: ENSMUSP00000033866
Gene: ENSMUSG00000031479
AA Change: W131*

DomainStartEndE-ValueType
Pfam:Vps36_ESCRT-II 2 88 1e-19 PFAM
Pfam:EAP30 154 369 1.4e-46 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a subunit of the endosomal sorting complex required for transport II (ESCRT-II). This protein complex functions in sorting of ubiquitinated membrane proteins during endocytosis. A similar protein complex in rat is associated with RNA polymerase elongation factor II. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Vps36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02577:Vps36 APN 8 22211616 nonsense probably null
IGL03035:Vps36 APN 8 22218415 missense probably benign 0.10
R0270:Vps36 UTSW 8 22210456 missense possibly damaging 0.85
R0532:Vps36 UTSW 8 22218245 missense probably benign 0.03
R1452:Vps36 UTSW 8 22218210 critical splice acceptor site probably null
R1880:Vps36 UTSW 8 22213562 critical splice donor site probably null
R2127:Vps36 UTSW 8 22218289 critical splice donor site probably null
R2128:Vps36 UTSW 8 22218289 critical splice donor site probably null
R3708:Vps36 UTSW 8 22192883 missense probably benign
R4583:Vps36 UTSW 8 22218420 missense probably benign 0.22
R4917:Vps36 UTSW 8 22218264 missense possibly damaging 0.93
R6354:Vps36 UTSW 8 22205755 missense probably damaging 1.00
R6597:Vps36 UTSW 8 22202304 missense probably benign
R7207:Vps36 UTSW 8 22211607 missense probably benign 0.28
R8251:Vps36 UTSW 8 22192916 missense probably benign 0.01
Z1177:Vps36 UTSW 8 22192830 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCATTCACTTCAGTTCCACTCACA -3'
(R):5'- AGGCACAGAGATGAAAACACTGTACC -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtTCTGAC -3'
(R):5'- ttgggaggctcaggtagg -3'
Posted On2013-11-08