Mutagenetix > Incidental Mutation

Incidental Mutation 'R0966:Efcab5'

84060

Institutional Source

Beutler Lab

Gene Symbol

Efcab5

Ensembl Gene

ENSMUSG00000050944

Gene Name

EF-hand calcium binding domain 5

Synonyms

4930563A03Rik

MMRRC Submission

039095-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R0966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77089915-77188968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 77140923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 42 (R42W)

Ref Sequence

ENSEMBL: ENSMUSP00000118152 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]

AlphaFold

A0JP43

Predicted Effect

probably damaging
Transcript: ENSMUST00000108400
AA Change: R178W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: R178W

Domain	Start	End	E-Value	Type
low complexity region	71	84	N/A	INTRINSIC
low complexity region	210	219	N/A	INTRINSIC
internal_repeat_1	250	352	2.42e-20	PROSPERO
internal_repeat_1	354	452	2.42e-20	PROSPERO
low complexity region	498	513	N/A	INTRINSIC
coiled coil region	749	776	N/A	INTRINSIC
GAF	877	1066	1.78e-2	SMART
low complexity region	1235	1245	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130901
AA Change: R42W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: R42W

Domain	Start	End	E-Value	Type
low complexity region	74	83	N/A	INTRINSIC
internal_repeat_1	114	216	1.89e-19	PROSPERO
internal_repeat_1	218	316	1.89e-19	PROSPERO
low complexity region	362	377	N/A	INTRINSIC
coiled coil region	613	640	N/A	INTRINSIC
GAF	741	930	1.78e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148985

Meta Mutation Damage Score

0.3850

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 96.8%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	A	16: 88,707,422	R162S	probably damaging	Het
Arhgef10	T	G	8: 14,940,343	S272A	probably benign	Het
Cd101	A	C	3: 101,008,222	S676R	probably benign	Het
Flrt2	T	C	12: 95,780,301	V471A	possibly damaging	Het
Fzd8	A	T	18: 9,214,745	E609V	probably damaging	Het
Gm10110	A	C	14: 89,898,119		noncoding transcript	Het
Gm5724	A	G	6: 141,727,573	F413S	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Igf2bp2	C	T	16: 22,089,090	R19Q	probably damaging	Het
Mmp16	C	G	4: 18,115,930	N511K	probably benign	Het
Myo7b	T	C	18: 31,998,763	H460R	probably damaging	Het
Olfr68	T	A	7: 103,777,449	T299S	probably damaging	Het
Plekhh1	T	C	12: 79,065,730	F594L	probably damaging	Het
Prkca	T	A	11: 108,014,284	K209N	possibly damaging	Het
Slc5a2	G	C	7: 128,270,631	R412P	probably damaging	Het
Ugt1a6b	G	A	1: 88,107,128	V63I	probably benign	Het
Ugt2b38	T	G	5: 87,412,373	N361H	probably damaging	Het
Vps36	G	A	8: 22,206,817	W131*	probably null	Het
Wdr3	A	T	3: 100,161,069	V41E	probably damaging	Het

Other mutations in Efcab5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Efcab5	APN	11	77137036	missense	probably benign	0.04
IGL01343:Efcab5	APN	11	77129930	missense	probably damaging	1.00
IGL02190:Efcab5	APN	11	77121314	missense	probably benign	0.38
IGL02270:Efcab5	APN	11	77104313	missense	probably damaging	0.97
IGL02572:Efcab5	APN	11	77137888	nonsense	probably null
IGL02653:Efcab5	APN	11	77132022	missense	probably damaging	0.99
IGL02818:Efcab5	APN	11	77105348	missense	probably damaging	0.99
IGL03068:Efcab5	APN	11	77104101	missense	probably benign
IGL03222:Efcab5	APN	11	77137367	missense	probably benign	0.40
IGL03226:Efcab5	APN	11	77137675	missense	possibly damaging	0.92
IGL03257:Efcab5	APN	11	77188770	missense	probably damaging	0.99
PIT4131001:Efcab5	UTSW	11	77137691
PIT4418001:Efcab5	UTSW	11	77132051	missense	possibly damaging	0.89
R0276:Efcab5	UTSW	11	77129876	missense	probably damaging	1.00
R0276:Efcab5	UTSW	11	77140923	missense	probably damaging	1.00
R0277:Efcab5	UTSW	11	77140923	missense	probably damaging	1.00
R0284:Efcab5	UTSW	11	77103527	intron	probably benign
R0386:Efcab5	UTSW	11	77140923	missense	probably damaging	1.00
R0386:Efcab5	UTSW	11	77172378	missense	probably benign	0.30
R0968:Efcab5	UTSW	11	77140923	missense	probably damaging	1.00
R1433:Efcab5	UTSW	11	77105378	missense	probably benign	0.09
R1673:Efcab5	UTSW	11	77151853	missense	probably damaging	0.99
R1842:Efcab5	UTSW	11	77134875	missense	probably benign	0.00
R1848:Efcab5	UTSW	11	77103306	missense	probably damaging	1.00
R2069:Efcab5	UTSW	11	77172321	missense	probably benign	0.06
R3713:Efcab5	UTSW	11	77116182	missense	probably damaging	1.00
R4012:Efcab5	UTSW	11	77117830	missense	probably damaging	0.98
R4020:Efcab5	UTSW	11	77104104	missense	probably benign	0.33
R4391:Efcab5	UTSW	11	77090458	missense	probably damaging	0.99
R4392:Efcab5	UTSW	11	77090458	missense	probably damaging	0.99
R4692:Efcab5	UTSW	11	77113681	missense	probably damaging	1.00
R4929:Efcab5	UTSW	11	77103383	missense	probably benign	0.36
R4985:Efcab5	UTSW	11	77138229	missense	probably damaging	0.98
R4988:Efcab5	UTSW	11	77137252	missense	probably damaging	1.00
R5246:Efcab5	UTSW	11	77188845	missense	probably damaging	1.00
R5260:Efcab5	UTSW	11	77137651	missense	possibly damaging	0.92
R5387:Efcab5	UTSW	11	77134842	missense	possibly damaging	0.93
R5516:Efcab5	UTSW	11	77188789	missense	possibly damaging	0.62
R5535:Efcab5	UTSW	11	77151921	missense	probably damaging	1.00
R5694:Efcab5	UTSW	11	77188875	missense	probably benign	0.09
R5922:Efcab5	UTSW	11	77188744	missense	probably benign	0.44
R6030:Efcab5	UTSW	11	77121262	missense	probably damaging	1.00
R6030:Efcab5	UTSW	11	77121262	missense	probably damaging	1.00
R6183:Efcab5	UTSW	11	77137258	missense	probably benign	0.04
R6437:Efcab5	UTSW	11	77137902	missense	probably benign	0.25
R6442:Efcab5	UTSW	11	77105434	nonsense	probably null
R6592:Efcab5	UTSW	11	77113610	missense	possibly damaging	0.90
R6769:Efcab5	UTSW	11	77105432	missense	probably damaging	0.98
R7257:Efcab5	UTSW	11	77137779	missense	probably damaging	0.99
R7285:Efcab5	UTSW	11	77137344	missense	probably benign
R7285:Efcab5	UTSW	11	77138215	missense	possibly damaging	0.49
R7350:Efcab5	UTSW	11	77137561	missense	probably benign	0.05
R7369:Efcab5	UTSW	11	77117835	missense	possibly damaging	0.60
R7760:Efcab5	UTSW	11	77151926	missense	probably benign	0.31
R8213:Efcab5	UTSW	11	77116071	missense	probably damaging	1.00
R8690:Efcab5	UTSW	11	77103289	missense	probably damaging	0.98
R9294:Efcab5	UTSW	11	77121238	missense	probably benign	0.03
R9310:Efcab5	UTSW	11	77113705	missense	probably benign	0.23
R9324:Efcab5	UTSW	11	77113720	missense	possibly damaging	0.95
R9404:Efcab5	UTSW	11	77132108	missense	probably damaging	0.99
R9405:Efcab5	UTSW	11	77132108	missense	probably damaging	0.99
R9407:Efcab5	UTSW	11	77132108	missense	probably damaging	0.99
R9509:Efcab5	UTSW	11	77104151	missense	possibly damaging	0.94
R9562:Efcab5	UTSW	11	77132108	missense	probably damaging	0.99
R9651:Efcab5	UTSW	11	77132108	missense	probably damaging	0.99
R9748:Efcab5	UTSW	11	77116196	nonsense	probably null
X0061:Efcab5	UTSW	11	77116234	missense	probably damaging	1.00
Z1176:Efcab5	UTSW	11	77132139	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTCATTGGACTACAACACCCAGC -3'
(R):5'- TTCAACAAGTCGTGCCAGTCCC -3'

Sequencing Primer
(F):5'- AGCTTCAGCTCCAGGACATTC -3'
(R):5'- CCTACGGGCAAGATATAGCTTC -3'

Posted On

2013-11-08