Incidental Mutation 'R0966:Gm10110'
ID84064
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R0966 (G1)
Quality Score109
Status Not validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to C at 89898119 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228705
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R1839:Gm10110 UTSW 14 89897836 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6333:Gm10110 UTSW 14 89898297 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCGAGACTTGAATCTACCCACGAAC -3'
(R):5'- CACCGAAGCCATGCTGTATGAAAAG -3'

Sequencing Primer
(F):5'- CACGAACACTTTACGGTCATTGAG -3'
(R):5'- GCTGTATGAAAAGTTTAGCCCTGC -3'
Posted On2013-11-08