Incidental Mutation 'R0966:2310061N02Rik'
ID84066
Institutional Source Beutler Lab
Gene Symbol 2310061N02Rik
Ensembl Gene ENSMUSG00000050704
Gene NameRIKEN cDNA 2310061N02 gene
Synonyms
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location88707169-88707962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88707422 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 162 (R162S)
Ref Sequence ENSEMBL: ENSMUSP00000062074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050882]
Predicted Effect probably damaging
Transcript: ENSMUST00000050882
AA Change: R162S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062074
Gene: ENSMUSG00000050704
AA Change: R162S

DomainStartEndE-ValueType
Pfam:PMG 1 169 1.7e-58 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in 2310061N02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0127:2310061N02Rik UTSW 16 88707454 missense probably benign 0.01
R1834:2310061N02Rik UTSW 16 88707898 missense unknown
R1854:2310061N02Rik UTSW 16 88707780 missense possibly damaging 0.74
R4792:2310061N02Rik UTSW 16 88707763 missense possibly damaging 0.95
R5431:2310061N02Rik UTSW 16 88707538 missense possibly damaging 0.67
R5896:2310061N02Rik UTSW 16 88707433 missense probably damaging 0.99
R6416:2310061N02Rik UTSW 16 88707891 missense unknown
R6737:2310061N02Rik UTSW 16 88707568 missense probably damaging 1.00
R7629:2310061N02Rik UTSW 16 88707405 missense probably benign 0.03
X0021:2310061N02Rik UTSW 16 88707897 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACCAACCCTGATGCAATGTC -3'
(R):5'- TACCGTCCAAGTGTGTCCAGCTTC -3'

Sequencing Primer
(F):5'- CGTACACGCTCCAAGAATTTATG -3'
(R):5'- TTGCAGGGCCACATATGC -3'
Posted On2013-11-08