Incidental Mutation 'R0966:Fzd8'
ID84067
Institutional Source Beutler Lab
Gene Symbol Fzd8
Ensembl Gene ENSMUSG00000036904
Gene Namefrizzled class receptor 8
SynonymsmFZ8, Fz8
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0966 (G1)
Quality Score200
Status Not validated
Chromosome18
Chromosomal Location9212856-9216201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9214745 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 609 (E609V)
Ref Sequence ENSEMBL: ENSMUSP00000039660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041080]
PDB Structure
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MOUSE FRIZZLED 8 (MFZ8) [X-RAY DIFFRACTION]
Crystal structure of XWnt8 in complex with the cysteine-rich domain of Frizzled 8 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041080
AA Change: E609V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039660
Gene: ENSMUSG00000036904
AA Change: E609V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 34 153 9.06e-73 SMART
low complexity region 161 228 N/A INTRINSIC
Frizzled 264 621 1.47e-219 SMART
low complexity region 624 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. This gene is highly expressed in two human cancer cell lines, indicating that it may play a role in several types of cancer. The crystal structure of the extracellular cysteine-rich domain of a similar mouse protein has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Wdr3 A T 3: 100,161,069 V41E probably damaging Het
Other mutations in Fzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fzd8 APN 18 9213068 missense unknown
IGL01511:Fzd8 APN 18 9213293 missense unknown
IGL03129:Fzd8 APN 18 9214270 missense probably damaging 1.00
Stilt UTSW 18 9213880 missense probably damaging 1.00
R0058:Fzd8 UTSW 18 9213985 missense possibly damaging 0.92
R0715:Fzd8 UTSW 18 9212947 missense unknown
R1717:Fzd8 UTSW 18 9214364 missense probably damaging 1.00
R1751:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1761:Fzd8 UTSW 18 9213643 missense probably damaging 0.98
R1905:Fzd8 UTSW 18 9213803 missense probably damaging 1.00
R1956:Fzd8 UTSW 18 9214502 missense probably damaging 1.00
R2892:Fzd8 UTSW 18 9214514 missense probably damaging 1.00
R3897:Fzd8 UTSW 18 9214939 missense possibly damaging 0.89
R3968:Fzd8 UTSW 18 9214070 missense probably damaging 0.98
R4934:Fzd8 UTSW 18 9214492 frame shift probably null
R5366:Fzd8 UTSW 18 9213880 missense probably damaging 1.00
R5624:Fzd8 UTSW 18 9213268 missense unknown
R6261:Fzd8 UTSW 18 9214598 missense possibly damaging 0.61
R6757:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6758:Fzd8 UTSW 18 9213238 missense possibly damaging 0.78
R6899:Fzd8 UTSW 18 9214729 missense probably damaging 0.98
R7242:Fzd8 UTSW 18 9214171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTTTCTATGAGCAGCACAACC -3'
(R):5'- TCAGACCTGGGACAATGGCATTTG -3'

Sequencing Primer
(F):5'- AGCAGCACAACCGACCG -3'
(R):5'- GCATTTGCTTAGGGTAAGATACAG -3'
Posted On2013-11-08