Mutagenetix > Incidental Mutations

Incidental Mutation 'R1083:Sulf1'

84902

Institutional Source

Beutler Lab

Gene Symbol

Sulf1

Ensembl Gene

ENSMUSG00000016918

Gene Name

sulfatase 1

Synonyms

MMRRC Submission

039169-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.513) question?

Stock #

R1083 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

12692277-12861192 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

AAGGGA to AAGGGAGGGA at 12836164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051]

AlphaFold

Q8K007

Predicted Effect

probably null
Transcript: ENSMUST00000088585

SMART Domains

Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000177608

SMART Domains

Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	534	678	9.7e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000180062

SMART Domains

Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.7e-59	PFAM
Pfam:Phosphodiest	61	323	9.2e-11	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	5e-52	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000186051

SMART Domains

Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sulfatase	43	374	7.4e-56	PFAM
Pfam:Phosphodiest	61	323	9.6e-8	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	679	1.1e-48	PFAM
low complexity region	717	737	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189447

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
Adamts17	G	A	7: 67,147,574	C986Y	probably damaging	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cdh2	T	C	18: 16,643,959	N273S	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Gpam	A	G	19: 55,088,211		probably benign	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Yes1	T	C	5: 32,651,757		probably null	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Sulf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Sulf1	APN	1	12820463	missense	probably damaging	0.99
IGL00788:Sulf1	APN	1	12848449	missense	probably damaging	0.99
IGL00845:Sulf1	APN	1	12796967	missense	probably damaging	1.00
IGL01606:Sulf1	APN	1	12836204	missense	possibly damaging	0.87
IGL01963:Sulf1	APN	1	12818507	missense	probably damaging	1.00
IGL01968:Sulf1	APN	1	12818451	missense	probably damaging	1.00
IGL02072:Sulf1	APN	1	12848208	missense	probably damaging	1.00
IGL02424:Sulf1	APN	1	12796840	missense	probably benign	0.28
IGL02519:Sulf1	APN	1	12838363	nonsense	probably null
IGL02601:Sulf1	APN	1	12786645	missense	probably damaging	1.00
IGL03066:Sulf1	APN	1	12807944	missense	probably damaging	0.99
IGL03200:Sulf1	APN	1	12786617	nonsense	probably null
PIT4480001:Sulf1	UTSW	1	12859413	missense	probably benign	0.01
PIT4519001:Sulf1	UTSW	1	12848171	missense	probably damaging	1.00
R0083:Sulf1	UTSW	1	12817417	missense	probably damaging	0.99
R0467:Sulf1	UTSW	1	12796920	missense	probably damaging	1.00
R0554:Sulf1	UTSW	1	12805194	missense	probably damaging	1.00
R0626:Sulf1	UTSW	1	12817492	splice site	probably null
R1084:Sulf1	UTSW	1	12836164	frame shift	probably null
R1498:Sulf1	UTSW	1	12848350	missense	probably damaging	1.00
R1523:Sulf1	UTSW	1	12817350	nonsense	probably null
R1854:Sulf1	UTSW	1	12838437	missense	probably benign	0.06
R1942:Sulf1	UTSW	1	12848173	missense	probably damaging	1.00
R1946:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R1998:Sulf1	UTSW	1	12858834	nonsense	probably null
R2034:Sulf1	UTSW	1	12820421	missense	probably damaging	1.00
R2068:Sulf1	UTSW	1	12840403	missense	probably damaging	1.00
R2113:Sulf1	UTSW	1	12848174	missense	probably damaging	0.99
R2277:Sulf1	UTSW	1	12796794	missense	probably benign	0.41
R3827:Sulf1	UTSW	1	12817432	missense	probably benign
R3874:Sulf1	UTSW	1	12817412	missense	probably damaging	1.00
R4488:Sulf1	UTSW	1	12786515	start gained	probably benign
R4619:Sulf1	UTSW	1	12786652	missense	probably damaging	1.00
R4743:Sulf1	UTSW	1	12836293	missense	probably benign	0.04
R4836:Sulf1	UTSW	1	12842686	missense	probably benign	0.02
R4918:Sulf1	UTSW	1	12818496	missense	probably damaging	1.00
R4958:Sulf1	UTSW	1	12796910	missense	probably benign	0.08
R5216:Sulf1	UTSW	1	12796874	missense	probably benign	0.28
R5225:Sulf1	UTSW	1	12841478	missense	probably benign
R5427:Sulf1	UTSW	1	12796912	missense	possibly damaging	0.84
R5450:Sulf1	UTSW	1	12796907	missense	probably benign	0.04
R5909:Sulf1	UTSW	1	12858815	missense	possibly damaging	0.94
R5912:Sulf1	UTSW	1	12786752	unclassified	probably benign
R5966:Sulf1	UTSW	1	12859412	missense	probably benign	0.06
R6339:Sulf1	UTSW	1	12838440	missense	probably damaging	1.00
R6841:Sulf1	UTSW	1	12838434	missense	probably damaging	1.00
R6880:Sulf1	UTSW	1	12842755	missense	probably damaging	1.00
R7110:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R7255:Sulf1	UTSW	1	12859008	missense	probably benign	0.00
R7275:Sulf1	UTSW	1	12850965	splice site	probably null
R7386:Sulf1	UTSW	1	12838361	missense	probably benign	0.07
R7611:Sulf1	UTSW	1	12836243	missense	probably benign
R7732:Sulf1	UTSW	1	12842789	missense	probably benign	0.11
R7796:Sulf1	UTSW	1	12858820	missense	probably benign	0.27
R7898:Sulf1	UTSW	1	12805294	missense	probably damaging	1.00
R7984:Sulf1	UTSW	1	12859273	missense	probably benign	0.00
R8003:Sulf1	UTSW	1	12838601	missense	probably damaging	1.00
R8684:Sulf1	UTSW	1	12796780	missense	probably benign	0.06
R8714:Sulf1	UTSW	1	12807917	missense	probably benign	0.07
R8723:Sulf1	UTSW	1	12786687	missense	probably damaging	1.00
R8988:Sulf1	UTSW	1	12836275	missense	probably benign
R9055:Sulf1	UTSW	1	12807963	missense	probably damaging	1.00
R9100:Sulf1	UTSW	1	12807894	missense	probably damaging	1.00
R9288:Sulf1	UTSW	1	12786603	missense	probably benign	0.09
R9358:Sulf1	UTSW	1	12820505	missense	probably damaging	1.00
R9387:Sulf1	UTSW	1	12838554	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CGGAGGATTCATTTATCAGCGCCAG -3'
(R):5'- AGGCACCGAGAACATCTCATTTGTG -3'

Sequencing Primer
(F):5'- AGGCAGTTCTGATTCCCAATG -3'
(R):5'- AATCACGGGGGAGGTTGTC -3'

Posted On

2013-11-18