Mutagenetix > Incidental Mutation

Incidental Mutation 'R1083:Sf3b1'

84903

Institutional Source

Beutler Lab

Gene Symbol

Sf3b1

Ensembl Gene

ENSMUSG00000025982

Gene Name

splicing factor 3b, subunit 1

Synonyms

Targ4, SAP155, Prp10, 2810001M05Rik, SF3b155

MMRRC Submission

039169-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54985169-55027481 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55019395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glutamine at position 12 (E12Q)

Ref Sequence

ENSEMBL: ENSMUSP00000139469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027127
AA Change: E12Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: E12Q

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC
internal_repeat_1	185	276	1.77e-12	PROSPERO
Pfam:SF3b1	329	452	1.2e-51	PFAM
SCOP:d1qbkb_	489	1289	5e-62	SMART
Blast:ARM	593	637	6e-13	BLAST
Blast:ARM	1005	1044	7e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189051

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191303
AA Change: E12Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: E12Q

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC

Meta Mutation Damage Score

0.1366

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
Adamts17	G	A	7: 67,147,574	C986Y	probably damaging	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cdh2	T	C	18: 16,643,959	N273S	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Gpam	A	G	19: 55,088,211		probably benign	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Yes1	T	C	5: 32,651,757		probably null	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Sf3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Sf3b1	APN	1	54987486	missense	probably damaging	1.00
IGL00815:Sf3b1	APN	1	54996931	splice site	probably benign
IGL01380:Sf3b1	APN	1	54987949	missense	probably damaging	1.00
IGL01390:Sf3b1	APN	1	54987429	missense	probably benign	0.17
IGL02974:Sf3b1	APN	1	55007707	missense	probably benign	0.00
IGL03159:Sf3b1	APN	1	55012213	missense	probably benign
Colt	UTSW	1	54997156	missense	probably benign	0.45
Glock	UTSW	1	55001046	missense	probably damaging	0.96
Handgun	UTSW	1	55007507	missense	probably damaging	1.00
Kalashnikov	UTSW	1	55019265	missense	probably damaging	0.99
Magazine	UTSW	1	55012182	nonsense	probably null
Revolver	UTSW	1	55019389	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0190:Sf3b1	UTSW	1	54990306	missense	probably damaging	0.99
R0277:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0323:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0369:Sf3b1	UTSW	1	54998108	missense	probably benign	0.10
R0396:Sf3b1	UTSW	1	55019271	missense	probably damaging	1.00
R0718:Sf3b1	UTSW	1	55019385	missense	probably damaging	0.99
R0991:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1082:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1084:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1196:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1381:Sf3b1	UTSW	1	55003154	missense	probably damaging	0.99
R1436:Sf3b1	UTSW	1	55001421	missense	possibly damaging	0.72
R1559:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1560:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1561:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1567:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1568:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1588:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R1625:Sf3b1	UTSW	1	55019377	missense	probably damaging	1.00
R1694:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1735:Sf3b1	UTSW	1	55000652	missense	probably damaging	1.00
R1900:Sf3b1	UTSW	1	54998188	missense	possibly damaging	0.75
R2186:Sf3b1	UTSW	1	55007633	missense	probably benign
R2429:Sf3b1	UTSW	1	55016801	missense	possibly damaging	0.71
R2473:Sf3b1	UTSW	1	54999626	critical splice donor site	probably null
R3772:Sf3b1	UTSW	1	54999991	intron	probably benign
R3911:Sf3b1	UTSW	1	55019389	nonsense	probably null
R3970:Sf3b1	UTSW	1	55012182	nonsense	probably null
R4706:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4707:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4964:Sf3b1	UTSW	1	54999712	missense	probably benign
R5053:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R5358:Sf3b1	UTSW	1	55003310	missense	probably benign	0.09
R5379:Sf3b1	UTSW	1	55003150	missense	possibly damaging	0.94
R5628:Sf3b1	UTSW	1	54998175	missense	probably benign	0.27
R5636:Sf3b1	UTSW	1	54997193	missense	probably damaging	1.00
R6013:Sf3b1	UTSW	1	55000298	missense	probably damaging	0.98
R6149:Sf3b1	UTSW	1	55007507	missense	probably damaging	1.00
R6217:Sf3b1	UTSW	1	55007518	missense	probably damaging	1.00
R6426:Sf3b1	UTSW	1	54999655	missense	probably benign	0.01
R6531:Sf3b1	UTSW	1	55019395	missense	probably damaging	0.99
R6945:Sf3b1	UTSW	1	54997156	missense	probably benign	0.45
R7001:Sf3b1	UTSW	1	55001046	missense	probably damaging	0.96
R7001:Sf3b1	UTSW	1	55014481	critical splice donor site	probably null
R7302:Sf3b1	UTSW	1	55016790	missense	probably benign	0.00
R7644:Sf3b1	UTSW	1	54997143	nonsense	probably null
R7664:Sf3b1	UTSW	1	54987467	missense	probably damaging	1.00
R7735:Sf3b1	UTSW	1	55003349	missense	probably benign	0.29
R7809:Sf3b1	UTSW	1	54995455	missense	possibly damaging	0.60
R8516:Sf3b1	UTSW	1	55012103	missense	probably null	0.01
R8871:Sf3b1	UTSW	1	54990349	missense	probably damaging	1.00
R8947:Sf3b1	UTSW	1	55000285	missense	probably damaging	1.00
R9216:Sf3b1	UTSW	1	55012217	missense	probably benign	0.00
Z1177:Sf3b1	UTSW	1	55003402	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGGTCAGGAGATACATGTGTAGAT -3'

Posted On

2013-11-18