Incidental Mutation 'R1083:Dut'
ID 84905
Institutional Source Beutler Lab
Gene Symbol Dut
Ensembl Gene ENSMUSG00000027203
Gene Name deoxyuridine triphosphatase
Synonyms Dutp, dUTPase, 5031412I06Rik, D2Bwg0749e, 5133400F09Rik
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock # R1083 (G1)
Quality Score 152
Status Validated
Chromosome 2
Chromosomal Location 125247190-125258608 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GCGGC to GCGGCCGGC at 125247828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051605] [ENSMUST00000082122]
AlphaFold Q8VCG1
Predicted Effect probably null
Transcript: ENSMUST00000051605
SMART Domains Protein: ENSMUSP00000057854
Gene: ENSMUSG00000027203

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:dUTPase 31 160 1.2e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082122
SMART Domains Protein: ENSMUSP00000080767
Gene: ENSMUSG00000027203

DomainStartEndE-ValueType
low complexity region 3 56 N/A INTRINSIC
Pfam:dUTPase 69 198 1.6e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133211
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Dut
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Dut UTSW 2 125257091 missense probably damaging 1.00
R6446:Dut UTSW 2 125251019 critical splice donor site probably null
R6607:Dut UTSW 2 125256867 missense probably damaging 1.00
R6888:Dut UTSW 2 125257124 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGAGCAGGTAACGGTGAGCC -3'
(R):5'- GCTGCACAGTAACGCTTTGGAAATG -3'

Sequencing Primer
(F):5'- ACGAGTCCATTGCGGACC -3'
(R):5'- TTTCCGCTCGCCCAAAC -3'
Posted On 2013-11-18