Incidental Mutation 'R1083:Atp11b'
ID 84907
Institutional Source Beutler Lab
Gene Symbol Atp11b
Ensembl Gene ENSMUSG00000037400
Gene Name ATPase, class VI, type 11B
Synonyms 1110019I14Rik
MMRRC Submission 039169-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 35808255-35910425 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 35832162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029257]
AlphaFold Q6DFW5
Predicted Effect probably benign
Transcript: ENSMUST00000029257
SMART Domains Protein: ENSMUSP00000029257
Gene: ENSMUSG00000037400

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 21 90 2.4e-24 PFAM
Pfam:E1-E2_ATPase 95 369 5.4e-13 PFAM
Pfam:Hydrolase 401 757 1.5e-10 PFAM
Pfam:HAD 404 829 5.9e-20 PFAM
Pfam:Cation_ATPase 492 605 7.1e-13 PFAM
Pfam:PhoLip_ATPase_C 846 1099 1.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200445
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] P-type ATPases, such as ATP11B, are phosphorylated in their intermediate state and drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily transports heavy metal ions, such as Cu(2+) or Cd(2+). Another subfamily transports non-heavy metal ions, such as H(+), Na(+), K(+), or Ca(+). A third subfamily transports amphipaths, such as phosphatidylserine.[supplied by OMIM, Feb 2005]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,805,046 (GRCm39) probably benign Het
Adamts17 G A 7: 66,797,322 (GRCm39) C986Y probably damaging Het
AI987944 A G 7: 41,024,763 (GRCm39) V75A probably benign Het
Arhgap10 T C 8: 78,244,378 (GRCm39) Y12C probably damaging Het
Ccer1 T A 10: 97,530,520 (GRCm39) D394E possibly damaging Het
Cdh2 T C 18: 16,777,016 (GRCm39) N273S possibly damaging Het
Cfap65 G T 1: 74,957,663 (GRCm39) probably benign Het
Crybb3 A T 5: 113,228,444 (GRCm39) probably benign Het
D7Ertd443e G A 7: 133,950,663 (GRCm39) Q337* probably null Het
Dixdc1 C T 9: 50,588,293 (GRCm39) probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,089,748 (GRCm39) probably null Het
Fbxo2 A G 4: 148,250,234 (GRCm39) probably null Het
Gm5174 T C 10: 86,491,972 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,076,643 (GRCm39) probably benign Het
Il12a C T 3: 68,602,666 (GRCm39) T112M probably damaging Het
Itpr1 T A 6: 108,487,657 (GRCm39) V2361D possibly damaging Het
Jag1 G A 2: 136,938,152 (GRCm39) L283F probably damaging Het
Lamb2 A C 9: 108,360,892 (GRCm39) D538A probably benign Het
Map10 T A 8: 126,397,178 (GRCm39) C190* probably null Het
Pcnx2 C T 8: 126,498,843 (GRCm39) R1552H probably damaging Het
Phf1 T C 17: 27,156,244 (GRCm39) probably benign Het
Pitx2 A G 3: 129,012,418 (GRCm39) T276A probably damaging Het
Pparg A G 6: 115,467,107 (GRCm39) D490G probably damaging Het
Rnf10 A T 5: 115,398,163 (GRCm39) probably benign Het
Sbp T C 17: 24,161,704 (GRCm39) probably benign Het
Setbp1 A T 18: 78,900,841 (GRCm39) L942H probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Sfmbt1 A T 14: 30,509,498 (GRCm39) N326Y possibly damaging Het
Slx4 G A 16: 3,808,774 (GRCm39) Q389* probably null Het
Srrm3 T A 5: 135,883,263 (GRCm39) V206E probably damaging Het
Sspo T A 6: 48,447,933 (GRCm39) D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,906,388 (GRCm39) probably null Het
Vmn1r14 T A 6: 57,211,184 (GRCm39) I210N probably damaging Het
Wasf3 T G 5: 146,372,182 (GRCm39) L13R probably damaging Het
Yes1 T C 5: 32,809,101 (GRCm39) probably null Het
Zfp292 T C 4: 34,807,569 (GRCm39) D1830G probably damaging Het
Zfp541 A G 7: 15,812,637 (GRCm39) N430S probably benign Het
Other mutations in Atp11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp11b APN 3 35,863,525 (GRCm39) splice site probably null
IGL00722:Atp11b APN 3 35,874,084 (GRCm39) missense probably damaging 1.00
IGL00725:Atp11b APN 3 35,881,222 (GRCm39) missense probably damaging 0.97
IGL01514:Atp11b APN 3 35,891,130 (GRCm39) missense probably damaging 1.00
IGL01532:Atp11b APN 3 35,903,651 (GRCm39) nonsense probably null
IGL01789:Atp11b APN 3 35,843,741 (GRCm39) missense possibly damaging 0.81
IGL01915:Atp11b APN 3 35,885,612 (GRCm39) missense probably damaging 1.00
IGL02009:Atp11b APN 3 35,868,301 (GRCm39) missense probably benign 0.07
IGL02049:Atp11b APN 3 35,854,642 (GRCm39) missense probably damaging 0.99
IGL02952:Atp11b APN 3 35,882,844 (GRCm39) missense probably damaging 1.00
IGL02991:Atp11b UTSW 3 35,881,140 (GRCm39) missense probably benign 0.00
R0044:Atp11b UTSW 3 35,866,401 (GRCm39) missense probably damaging 0.99
R0254:Atp11b UTSW 3 35,866,259 (GRCm39) missense possibly damaging 0.82
R0538:Atp11b UTSW 3 35,891,163 (GRCm39) missense probably damaging 1.00
R0541:Atp11b UTSW 3 35,861,093 (GRCm39) missense probably damaging 0.99
R0653:Atp11b UTSW 3 35,893,343 (GRCm39) missense probably damaging 0.99
R0790:Atp11b UTSW 3 35,887,072 (GRCm39) missense probably damaging 1.00
R1371:Atp11b UTSW 3 35,860,918 (GRCm39) missense probably damaging 0.97
R1458:Atp11b UTSW 3 35,843,707 (GRCm39) missense probably damaging 1.00
R1875:Atp11b UTSW 3 35,893,296 (GRCm39) missense probably damaging 1.00
R1921:Atp11b UTSW 3 35,888,474 (GRCm39) missense probably damaging 1.00
R2008:Atp11b UTSW 3 35,909,271 (GRCm39) missense probably damaging 0.97
R2065:Atp11b UTSW 3 35,893,223 (GRCm39) missense probably damaging 1.00
R2112:Atp11b UTSW 3 35,891,677 (GRCm39) missense probably damaging 1.00
R2228:Atp11b UTSW 3 35,861,091 (GRCm39) missense probably damaging 1.00
R2270:Atp11b UTSW 3 35,864,283 (GRCm39) splice site probably null
R2273:Atp11b UTSW 3 35,882,762 (GRCm39) missense probably benign 0.04
R2439:Atp11b UTSW 3 35,868,233 (GRCm39) missense possibly damaging 0.68
R2497:Atp11b UTSW 3 35,909,294 (GRCm39) missense probably damaging 0.99
R4181:Atp11b UTSW 3 35,854,714 (GRCm39) missense probably benign 0.19
R4181:Atp11b UTSW 3 35,843,707 (GRCm39) missense probably damaging 1.00
R4714:Atp11b UTSW 3 35,888,543 (GRCm39) missense probably benign 0.02
R4923:Atp11b UTSW 3 35,889,528 (GRCm39) critical splice donor site probably null
R4937:Atp11b UTSW 3 35,861,157 (GRCm39) splice site probably null
R5013:Atp11b UTSW 3 35,888,532 (GRCm39) missense possibly damaging 0.66
R5058:Atp11b UTSW 3 35,863,510 (GRCm39) missense probably benign 0.41
R5171:Atp11b UTSW 3 35,887,086 (GRCm39) missense probably damaging 1.00
R5200:Atp11b UTSW 3 35,891,156 (GRCm39) missense probably benign 0.21
R5465:Atp11b UTSW 3 35,864,333 (GRCm39) missense probably benign 0.00
R5651:Atp11b UTSW 3 35,909,289 (GRCm39) missense probably damaging 1.00
R5689:Atp11b UTSW 3 35,888,501 (GRCm39) missense possibly damaging 0.67
R5718:Atp11b UTSW 3 35,891,665 (GRCm39) missense probably benign 0.12
R5807:Atp11b UTSW 3 35,866,428 (GRCm39) missense probably damaging 1.00
R5888:Atp11b UTSW 3 35,891,696 (GRCm39) missense probably benign 0.15
R6059:Atp11b UTSW 3 35,868,326 (GRCm39) missense possibly damaging 0.72
R6259:Atp11b UTSW 3 35,861,050 (GRCm39) missense probably damaging 1.00
R6359:Atp11b UTSW 3 35,832,210 (GRCm39) missense probably benign 0.04
R6367:Atp11b UTSW 3 35,838,686 (GRCm39) missense probably damaging 1.00
R6577:Atp11b UTSW 3 35,893,311 (GRCm39) missense probably damaging 0.99
R6818:Atp11b UTSW 3 35,868,329 (GRCm39) missense possibly damaging 0.71
R7016:Atp11b UTSW 3 35,895,185 (GRCm39) missense probably benign
R7178:Atp11b UTSW 3 35,874,099 (GRCm39) missense probably benign 0.34
R7614:Atp11b UTSW 3 35,864,259 (GRCm39) splice site probably null
R7729:Atp11b UTSW 3 35,832,256 (GRCm39) missense probably damaging 0.97
R7910:Atp11b UTSW 3 35,885,652 (GRCm39) missense possibly damaging 0.68
R7967:Atp11b UTSW 3 35,895,192 (GRCm39) missense probably benign 0.03
R8085:Atp11b UTSW 3 35,895,185 (GRCm39) missense probably benign
R8095:Atp11b UTSW 3 35,888,565 (GRCm39) missense probably damaging 1.00
R8499:Atp11b UTSW 3 35,864,854 (GRCm39) missense probably benign 0.01
R8672:Atp11b UTSW 3 35,874,066 (GRCm39) missense probably benign 0.19
R9046:Atp11b UTSW 3 35,852,740 (GRCm39) splice site probably benign
R9047:Atp11b UTSW 3 35,861,038 (GRCm39) missense probably damaging 0.98
R9065:Atp11b UTSW 3 35,887,131 (GRCm39) critical splice donor site probably null
R9713:Atp11b UTSW 3 35,885,560 (GRCm39) missense probably damaging 1.00
R9761:Atp11b UTSW 3 35,903,621 (GRCm39) missense probably benign 0.25
R9761:Atp11b UTSW 3 35,903,616 (GRCm39) missense probably damaging 1.00
R9761:Atp11b UTSW 3 35,903,607 (GRCm39) nonsense probably null
Z1088:Atp11b UTSW 3 35,866,362 (GRCm39) missense probably damaging 1.00
Z1177:Atp11b UTSW 3 35,861,003 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTTCACCTGGGAAGAAAAGCATTGG -3'
(R):5'- AGACTCAGAAGACAGCTATCACAGTACG -3'

Sequencing Primer
(F):5'- AAAAGCATTGGTGGCTTACCTG -3'
(R):5'- actgaagactgaactaagggc -3'
Posted On 2013-11-18