Incidental Mutation 'R1083:Pitx2'
ID84909
Institutional Source Beutler Lab
Gene Symbol Pitx2
Ensembl Gene ENSMUSG00000028023
Gene Namepaired-like homeodomain transcription factor 2
SynonymsPitx2b, Pitx2a, Brx1, solurshin, Brx1a, Brx1b, Ptx2, Otlx2, Pitx2c, Rieg, Munc30
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1083 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129199878-129219591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129218769 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 276 (T276A)
Ref Sequence ENSEMBL: ENSMUSP00000133756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029657] [ENSMUST00000042587] [ENSMUST00000106382] [ENSMUST00000172645] [ENSMUST00000174623] [ENSMUST00000174661]
AlphaFold P97474
Predicted Effect probably benign
Transcript: ENSMUST00000029657
Predicted Effect probably damaging
Transcript: ENSMUST00000042587
AA Change: T283A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047359
Gene: ENSMUSG00000028023
AA Change: T283A

DomainStartEndE-ValueType
HOX 92 154 6.5e-26 SMART
low complexity region 213 236 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
Pfam:OAR 282 300 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106382
AA Change: T230A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101990
Gene: ENSMUSG00000028023
AA Change: T230A

DomainStartEndE-ValueType
HOX 39 101 6.5e-26 SMART
low complexity region 160 183 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Pfam:OAR 228 248 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172645
AA Change: T263A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134692
Gene: ENSMUSG00000028023
AA Change: T263A

DomainStartEndE-ValueType
HOX 72 134 6.5e-26 SMART
low complexity region 193 216 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
low complexity region 243 260 N/A INTRINSIC
Pfam:OAR 262 280 9.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174623
SMART Domains Protein: ENSMUSP00000139328
Gene: ENSMUSG00000028023

DomainStartEndE-ValueType
HOX 92 151 1.37e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174661
AA Change: T276A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133756
Gene: ENSMUSG00000028023
AA Change: T276A

DomainStartEndE-ValueType
HOX 85 147 6.5e-26 SMART
low complexity region 206 229 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
Pfam:OAR 274 294 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199637
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show failed ventral body wall closure, right pulmonary isomerism, septal and valve defects, absent ocular muscles, arrested pituitary and tooth development, optic nerve, mandible and maxilla defects, and embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Pitx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pitx2 APN 3 129214764 missense probably damaging 0.99
IGL02110:Pitx2 APN 3 129218817 missense probably damaging 0.99
Chihuahua UTSW 3 129215840 missense probably damaging 1.00
milly UTSW 3 129218574 missense probably damaging 1.00
R0014:Pitx2 UTSW 3 129218499 missense possibly damaging 0.70
R1474:Pitx2 UTSW 3 129218839 missense probably damaging 1.00
R1789:Pitx2 UTSW 3 129218754 missense probably damaging 1.00
R1945:Pitx2 UTSW 3 129218536 missense probably damaging 1.00
R5305:Pitx2 UTSW 3 129215840 missense probably damaging 1.00
R5950:Pitx2 UTSW 3 129218520 missense probably damaging 1.00
R6114:Pitx2 UTSW 3 129204413 splice site probably null
R6189:Pitx2 UTSW 3 129218469 missense probably damaging 1.00
R6192:Pitx2 UTSW 3 129215872 missense probably benign 0.09
R6226:Pitx2 UTSW 3 129215842 missense probably damaging 1.00
R6526:Pitx2 UTSW 3 129214783 critical splice donor site probably null
R6778:Pitx2 UTSW 3 129218743 missense probably damaging 1.00
R6885:Pitx2 UTSW 3 129218608 missense probably damaging 1.00
R7575:Pitx2 UTSW 3 129215726 missense probably damaging 1.00
R8390:Pitx2 UTSW 3 129218858 missense probably damaging 0.96
R8766:Pitx2 UTSW 3 129218574 missense probably damaging 1.00
R9021:Pitx2 UTSW 3 129214783 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGTACCCCGGCTATTCGTACAAC -3'
(R):5'- CGCACGACCTTCTAGCACAATTCTC -3'

Sequencing Primer
(F):5'- TCGTACAACAATTGGGCTGC -3'
(R):5'- AATTCTCAGTCTTTCTGGGGCAG -3'
Posted On2013-11-18