Incidental Mutation 'R1083:Fbxo2'
ID 84911
Institutional Source Beutler Lab
Gene Symbol Fbxo2
Ensembl Gene ENSMUSG00000041556
Gene Name F-box protein 2
Synonyms Prpl4, Fbs1, NFB42, FBX2
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 148160621-148166424 bp(+) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) A to G at 148165777 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047951]
AlphaFold Q80UW2
PDB Structure Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis of sugar-recognizing ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Structural basis for selection of glycosylated substrate by SCFFbs1 ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of the Sugar Recognizing SCF Ubiquitin Ligase at 1.7 Resolution [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000047951
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is highly similar to the rat NFB42 (neural F Box 42 kDa) protein which is enriched in the nervous system and may play a role in maintaining neurons in a postmitotic state. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are behaviorally normal but display accelerated, age-related hearing loss associated with cochlear degeneration. Cellular degeneration begins at 2 months in the supporting cells of the organ of Corti and progresses to cochlear hair cells and the spiral ganglion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Fbxo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Fbxo2 APN 4 148165706 missense probably benign 0.01
IGL01690:Fbxo2 APN 4 148165124 critical splice donor site probably null
R0085:Fbxo2 UTSW 4 148164910 splice site probably null
R2879:Fbxo2 UTSW 4 148166011 missense probably damaging 1.00
R4583:Fbxo2 UTSW 4 148164899 missense possibly damaging 0.54
R5108:Fbxo2 UTSW 4 148166029 missense probably damaging 1.00
R6529:Fbxo2 UTSW 4 148165054 missense probably damaging 1.00
R6715:Fbxo2 UTSW 4 148165769 missense probably benign 0.00
R7772:Fbxo2 UTSW 4 148164326 missense probably damaging 1.00
R9147:Fbxo2 UTSW 4 148165709 missense probably damaging 0.96
R9148:Fbxo2 UTSW 4 148165709 missense probably damaging 0.96
R9176:Fbxo2 UTSW 4 148165690 missense probably damaging 1.00
R9422:Fbxo2 UTSW 4 148164159 missense unknown
Z1177:Fbxo2 UTSW 4 148165062 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAGGGATTAGCTCTTTGCCACAC -3'
(R):5'- GAAAGGATAGCACGTCAGCCTCAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCAGCCTCAGGGGTCTAAG -3'
Posted On 2013-11-18