Incidental Mutation 'R1083:Yes1'
ID 84912
Institutional Source Beutler Lab
Gene Symbol Yes1
Ensembl Gene ENSMUSG00000014932
Gene Name YES proto-oncogene 1, Src family tyrosine kinase
Synonyms Yes
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 32611171-32687057 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 32651757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]
AlphaFold Q04736
Predicted Effect probably null
Transcript: ENSMUST00000072311
SMART Domains Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155976
Predicted Effect probably null
Transcript: ENSMUST00000168707
SMART Domains Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200999
SMART Domains Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 3.1e-24 SMART
SH2 154 198 2e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202543
SMART Domains Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Yes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Yes1 APN 5 32655129 missense probably benign 0.00
IGL02816:Yes1 APN 5 32645107 missense probably damaging 1.00
IGL02974:Yes1 APN 5 32660768 missense probably damaging 0.97
PIT4696001:Yes1 UTSW 5 32684625 missense possibly damaging 0.70
R0139:Yes1 UTSW 5 32684695 missense possibly damaging 0.87
R0481:Yes1 UTSW 5 32640405 nonsense probably null
R0486:Yes1 UTSW 5 32655582 nonsense probably null
R0526:Yes1 UTSW 5 32655240 missense probably benign 0.15
R0648:Yes1 UTSW 5 32655518 missense possibly damaging 0.90
R1463:Yes1 UTSW 5 32651702 missense probably benign 0.04
R1569:Yes1 UTSW 5 32653163 missense probably damaging 1.00
R1899:Yes1 UTSW 5 32645051 missense probably damaging 1.00
R1918:Yes1 UTSW 5 32684735 missense probably benign 0.00
R2183:Yes1 UTSW 5 32645026 missense probably damaging 1.00
R2913:Yes1 UTSW 5 32640582 missense probably benign
R2914:Yes1 UTSW 5 32640582 missense probably benign
R3104:Yes1 UTSW 5 32653171 missense probably damaging 1.00
R4407:Yes1 UTSW 5 32640585 missense possibly damaging 0.51
R4736:Yes1 UTSW 5 32660777 missense probably damaging 0.98
R4939:Yes1 UTSW 5 32645113 splice site probably null
R6187:Yes1 UTSW 5 32645041 missense probably damaging 1.00
R6318:Yes1 UTSW 5 32651686 missense possibly damaging 0.92
R6467:Yes1 UTSW 5 32653037 missense probably damaging 0.98
R7578:Yes1 UTSW 5 32645086 missense probably benign 0.27
R7756:Yes1 UTSW 5 32684680 missense probably damaging 1.00
R8154:Yes1 UTSW 5 32645022 missense probably damaging 0.99
R8224:Yes1 UTSW 5 32659073 missense probably benign
R9043:Yes1 UTSW 5 32652968 missense probably damaging 1.00
X0062:Yes1 UTSW 5 32653043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTGTGCTTTGTGTGAACTTAATTGCC -3'
(R):5'- GCAAGGAGCTGAAAAGACAGTCTGTG -3'

Sequencing Primer
(F):5'- AATGGAAATGGTTTCTGATCTTTGC -3'
(R):5'- CTGAAAAGACAGTCTGTGGCATAC -3'
Posted On 2013-11-18