Mutagenetix > Incidental Mutations

Incidental Mutation 'R1083:Yes1'

84912

Institutional Source

Beutler Lab

Gene Symbol

Yes1

Ensembl Gene

ENSMUSG00000014932

Gene Name

YES proto-oncogene 1, Src family tyrosine kinase

Synonyms

Yes

MMRRC Submission

039169-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R1083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32611171-32687057 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 32651757 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]

Predicted Effect

probably null
Transcript: ENSMUST00000072311

SMART Domains

Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
SH3	92	149	5.03e-22	SMART
SH2	154	244	8.4e-35	SMART
TyrKc	275	524	8.39e-131	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155976

Predicted Effect

probably null
Transcript: ENSMUST00000168707

SMART Domains

Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
SH3	92	149	5.03e-22	SMART
SH2	154	244	8.4e-35	SMART
TyrKc	275	524	8.39e-131	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000200999

SMART Domains

Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
SH3	92	149	3.1e-24	SMART
SH2	154	198	2e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000202543

SMART Domains

Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
SH3	92	149	5.03e-22	SMART
SH2	154	244	8.4e-35	SMART
TyrKc	275	524	8.39e-131	SMART

Meta Mutation Damage Score

0.49

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
Adamts17	G	A	7: 67,147,574	C986Y	probably damaging	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cdh2	T	C	18: 16,643,959	N273S	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Gpam	A	G	19: 55,088,211		probably benign	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Yes1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Yes1	APN	5	32655129	missense	probably benign	0.00
IGL02816:Yes1	APN	5	32645107	missense	probably damaging	1.00
IGL02974:Yes1	APN	5	32660768	missense	probably damaging	0.97
PIT4696001:Yes1	UTSW	5	32684625	missense	possibly damaging	0.70
R0139:Yes1	UTSW	5	32684695	missense	possibly damaging	0.87
R0481:Yes1	UTSW	5	32640405	nonsense	probably null
R0486:Yes1	UTSW	5	32655582	nonsense	probably null
R0526:Yes1	UTSW	5	32655240	missense	probably benign	0.15
R0648:Yes1	UTSW	5	32655518	missense	possibly damaging	0.90
R1463:Yes1	UTSW	5	32651702	missense	probably benign	0.04
R1569:Yes1	UTSW	5	32653163	missense	probably damaging	1.00
R1899:Yes1	UTSW	5	32645051	missense	probably damaging	1.00
R1918:Yes1	UTSW	5	32684735	missense	probably benign	0.00
R2183:Yes1	UTSW	5	32645026	missense	probably damaging	1.00
R2913:Yes1	UTSW	5	32640582	missense	probably benign
R2914:Yes1	UTSW	5	32640582	missense	probably benign
R3104:Yes1	UTSW	5	32653171	missense	probably damaging	1.00
R4407:Yes1	UTSW	5	32640585	missense	possibly damaging	0.51
R4736:Yes1	UTSW	5	32660777	missense	probably damaging	0.98
R4939:Yes1	UTSW	5	32645113	splice site	probably null
R6187:Yes1	UTSW	5	32645041	missense	probably damaging	1.00
R6318:Yes1	UTSW	5	32651686	missense	possibly damaging	0.92
R6467:Yes1	UTSW	5	32653037	missense	probably damaging	0.98
X0062:Yes1	UTSW	5	32653043	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTTGTGCTTTGTGTGAACTTAATTGCC -3'
(R):5'- GCAAGGAGCTGAAAAGACAGTCTGTG -3'

Sequencing Primer
(F):5'- AATGGAAATGGTTTCTGATCTTTGC -3'
(R):5'- CTGAAAAGACAGTCTGTGGCATAC -3'

Posted On

2013-11-18