Incidental Mutation 'R1083:Rnf10'
ID84913
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Namering finger protein 10
Synonyms
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R1083 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115241412-115272898 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 115260104 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000112096] [ENSMUST00000112097]
Predicted Effect probably benign
Transcript: ENSMUST00000040555
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112096
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133276
Predicted Effect probably benign
Transcript: ENSMUST00000139853
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202855
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115256983 missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115251102 nonsense probably null
IGL02291:Rnf10 APN 5 115260196 missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115242666 missense probably benign 0.20
IGL02897:Rnf10 APN 5 115248641 missense probably benign
IGL02968:Rnf10 APN 5 115245888 missense probably benign 0.05
IGL03008:Rnf10 APN 5 115251296 missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115272367 missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115255447 splice site probably benign
R1754:Rnf10 UTSW 5 115245865 missense probably damaging 0.99
R1957:Rnf10 UTSW 5 115260322 splice site probably benign
R2398:Rnf10 UTSW 5 115247273 missense probably benign 0.33
R2848:Rnf10 UTSW 5 115249112 missense probably benign
R2849:Rnf10 UTSW 5 115249112 missense probably benign
R4527:Rnf10 UTSW 5 115260151 missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115248703 missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115251089 missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115255442 critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115249998 missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115244068 missense probably benign
R6192:Rnf10 UTSW 5 115257077 missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115257090 missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115244121 missense probably benign 0.04
R7213:Rnf10 UTSW 5 115242473 missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115242474 missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115248680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCTGAGACTAAGGAGTTCAGC -3'
(R):5'- GTTACAATCGCAAGCGTGAACCC -3'

Sequencing Primer
(F):5'- TATTACTCAAGTGCTCCAGAGGG -3'
(R):5'- AGCGTGAACCCTCCTACC -3'
Posted On2013-11-18