Incidental Mutation 'R1083:Srrm3'
ID84914
Institutional Source Beutler Lab
Gene Symbol Srrm3
Ensembl Gene ENSMUSG00000039860
Gene Nameserine/arginine repetitive matrix 3
Synonyms2900083I11Rik, Srrm2l, SRm300-like
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R1083 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135806890-135874772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135854409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 206 (V206E)
Ref Sequence ENSEMBL: ENSMUSP00000115695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013615] [ENSMUST00000126232] [ENSMUST00000144211]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013615
AA Change: V206E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860
AA Change: V206E

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135615
Predicted Effect probably damaging
Transcript: ENSMUST00000144211
AA Change: V206E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860
AA Change: V206E

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Srrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Srrm3 APN 5 135835249 missense probably damaging 1.00
IGL02716:Srrm3 APN 5 135854433 splice site probably null
IGL03099:Srrm3 APN 5 135869298 splice site probably benign
P0047:Srrm3 UTSW 5 135852926 splice site probably null
R0688:Srrm3 UTSW 5 135869276 utr 3 prime probably benign
R0811:Srrm3 UTSW 5 135873282 unclassified probably benign
R0812:Srrm3 UTSW 5 135873282 unclassified probably benign
R1161:Srrm3 UTSW 5 135854392 small deletion probably benign
R1656:Srrm3 UTSW 5 135835038 critical splice acceptor site probably null
R1694:Srrm3 UTSW 5 135873225 unclassified probably benign
R1803:Srrm3 UTSW 5 135857129 missense probably damaging 0.99
R2037:Srrm3 UTSW 5 135854377 missense probably damaging 1.00
R2436:Srrm3 UTSW 5 135835176 nonsense probably null
R3826:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R3829:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R4840:Srrm3 UTSW 5 135854595 missense possibly damaging 0.81
R6526:Srrm3 UTSW 5 135835234 missense probably damaging 1.00
R6843:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R7408:Srrm3 UTSW 5 135852206 missense probably benign 0.04
R7583:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R8096:Srrm3 UTSW 5 135869240 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCCAGTCTGACCCATAAGCTCC -3'
(R):5'- AGCACAGCTCACCTGTATCGTCTC -3'

Sequencing Primer
(F):5'- CCAGGTCATTCTATCCAAGGG -3'
(R):5'- TCTTCCTCCGGGACCCAG -3'
Posted On2013-11-18