Incidental Mutation 'R1083:Wasf3'
ID 84915
Institutional Source Beutler Lab
Gene Symbol Wasf3
Ensembl Gene ENSMUSG00000029636
Gene Name WAS protein family, member 3
Synonyms Wave3
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1083 (G1)
Quality Score 117
Status Validated
Chromosome 5
Chromosomal Location 146384985-146473615 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 146435372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 13 (L13R)
Ref Sequence ENSEMBL: ENSMUSP00000016143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016143]
AlphaFold Q8VHI6
Predicted Effect probably damaging
Transcript: ENSMUST00000016143
AA Change: L13R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016143
Gene: ENSMUSG00000029636
AA Change: L13R

DomainStartEndE-ValueType
PDB:3P8C|D 1 171 1e-86 PDB
low complexity region 172 184 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 395 422 N/A INTRINSIC
WH2 439 456 4.97e-5 SMART
low complexity region 484 501 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. A pseudogene of this gene have been defined on chromosome 6. Alternative splicing results in multiple transcript variants [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Wasf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wasf3 APN 5 146455651 missense probably damaging 1.00
IGL01992:Wasf3 APN 5 146455591 missense probably damaging 1.00
IGL02866:Wasf3 APN 5 146468321 missense probably benign 0.28
FR4737:Wasf3 UTSW 5 146470250 missense probably damaging 0.99
R0622:Wasf3 UTSW 5 146466792 splice site probably null
R1214:Wasf3 UTSW 5 146470288 missense probably damaging 1.00
R1259:Wasf3 UTSW 5 146451976 missense probably damaging 1.00
R1355:Wasf3 UTSW 5 146470208 splice site probably benign
R1370:Wasf3 UTSW 5 146470208 splice site probably benign
R1727:Wasf3 UTSW 5 146466959 missense probably benign
R4837:Wasf3 UTSW 5 146460978 missense probably benign 0.16
R5080:Wasf3 UTSW 5 146461097 missense probably benign
R6046:Wasf3 UTSW 5 146470356 missense unknown
R6386:Wasf3 UTSW 5 146453417 missense possibly damaging 0.77
R7181:Wasf3 UTSW 5 146466805 missense probably benign
R7229:Wasf3 UTSW 5 146455653 missense probably damaging 1.00
R8438:Wasf3 UTSW 5 146453427 missense probably benign
R8830:Wasf3 UTSW 5 146466862 nonsense probably null
R8909:Wasf3 UTSW 5 146455600 missense
R9182:Wasf3 UTSW 5 146466825 nonsense probably null
R9287:Wasf3 UTSW 5 146461047 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CTTCTAGCCAACCCTTTCACACAGG -3'
(R):5'- TCCTCACAGTTGCCACTCACAAGTC -3'

Sequencing Primer
(F):5'- GGCTAATTGAAATTCCTGATCAACTG -3'
(R):5'- GTTGCCACTCACAAGTCAAATC -3'
Posted On 2013-11-18