Incidental Mutation 'R1083:A730049H05Rik'
ID 84918
Institutional Source Beutler Lab
Gene Symbol A730049H05Rik
Ensembl Gene ENSMUSG00000048636
Gene Name RIKEN cDNA A730049H05 gene
Synonyms
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 92816478-92847174 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 92828065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057977] [ENSMUST00000113438] [ENSMUST00000167391]
AlphaFold Q8C940
Predicted Effect unknown
Transcript: ENSMUST00000057977
AA Change: S69P
SMART Domains Protein: ENSMUSP00000051623
Gene: ENSMUSG00000048636
AA Change: S69P

DomainStartEndE-ValueType
low complexity region 72 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113438
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133858
Predicted Effect probably benign
Transcript: ENSMUST00000167391
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in A730049H05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:A730049H05Rik APN 6 92828000 intron probably benign
IGL02037:A730049H05Rik APN 6 92828016 intron probably benign
IGL02047:A730049H05Rik APN 6 92831928 intron probably benign
R3931:A730049H05Rik UTSW 6 92834439 intron probably benign
R6992:A730049H05Rik UTSW 6 92827994 intron probably benign
R7653:A730049H05Rik UTSW 6 92828069 missense unknown
R7886:A730049H05Rik UTSW 6 92834456 missense unknown
R8801:A730049H05Rik UTSW 6 92831991 missense unknown
R9033:A730049H05Rik UTSW 6 92831953 missense unknown
R9217:A730049H05Rik UTSW 6 92831986 missense unknown
X0065:A730049H05Rik UTSW 6 92831935 critical splice acceptor site probably null
Z1176:A730049H05Rik UTSW 6 92828066 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGACGCTTTGCACTCACTAAC -3'
(R):5'- ACATCTGGTACAGTTCGACCAGTCC -3'

Sequencing Primer
(F):5'- GAAATTCCTGCATTTCAACTCAGC -3'
(R):5'- GACCAGTCCTGGCCTACATTC -3'
Posted On 2013-11-18