Incidental Mutation 'R1083:Zfp541'
ID 84921
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Name zinc finger protein 541
Synonyms EG666528
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.728) question?
Stock # R1083 (G1)
Quality Score 216
Status Not validated
Chromosome 7
Chromosomal Location 16061814-16096334 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16078712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 430 (N430S)
Ref Sequence ENSEMBL: ENSMUSP00000148143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
AlphaFold Q0GGX2
Predicted Effect probably benign
Transcript: ENSMUST00000108509
AA Change: N430S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: N430S

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209369
AA Change: N430S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000210805
AA Change: N430S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 16079468 missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 16079695 missense probably damaging 1.00
IGL02347:Zfp541 APN 7 16083465 missense probably damaging 1.00
IGL02516:Zfp541 APN 7 16082993 splice site probably null
R0101:Zfp541 UTSW 7 16078043 missense probably damaging 1.00
R0412:Zfp541 UTSW 7 16082174 missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 16095682 splice site probably benign
R0784:Zfp541 UTSW 7 16082992 intron probably benign
R1541:Zfp541 UTSW 7 16078512 missense probably benign 0.04
R1575:Zfp541 UTSW 7 16078715 missense possibly damaging 0.94
R1730:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1783:Zfp541 UTSW 7 16077973 missense probably damaging 0.99
R1966:Zfp541 UTSW 7 16079071 missense probably benign 0.02
R2022:Zfp541 UTSW 7 16082185 missense probably damaging 1.00
R2048:Zfp541 UTSW 7 16078327 missense possibly damaging 0.94
R2436:Zfp541 UTSW 7 16076448 missense possibly damaging 0.94
R3973:Zfp541 UTSW 7 16072222 missense probably damaging 1.00
R4081:Zfp541 UTSW 7 16072135 missense probably benign 0.16
R4589:Zfp541 UTSW 7 16083336 missense probably benign 0.35
R4724:Zfp541 UTSW 7 16081687 missense probably damaging 0.99
R4812:Zfp541 UTSW 7 16079110 missense probably benign 0.01
R4817:Zfp541 UTSW 7 16090382 missense probably damaging 1.00
R5232:Zfp541 UTSW 7 16095179 missense probably damaging 1.00
R5331:Zfp541 UTSW 7 16095758 missense probably damaging 1.00
R5551:Zfp541 UTSW 7 16090861 missense probably damaging 1.00
R5976:Zfp541 UTSW 7 16076419 missense probably benign 0.34
R6259:Zfp541 UTSW 7 16095526 missense probably benign 0.02
R6523:Zfp541 UTSW 7 16095520 missense probably damaging 1.00
R6826:Zfp541 UTSW 7 16078982 missense probably damaging 0.96
R7319:Zfp541 UTSW 7 16079369 missense probably benign 0.21
R7428:Zfp541 UTSW 7 16092868 missense probably damaging 1.00
R7594:Zfp541 UTSW 7 16076386 missense probably damaging 0.96
R7724:Zfp541 UTSW 7 16071994 missense probably damaging 1.00
R8276:Zfp541 UTSW 7 16079084 missense possibly damaging 0.87
R8433:Zfp541 UTSW 7 16072074 missense probably benign 0.16
R9068:Zfp541 UTSW 7 16078451 missense probably damaging 0.96
R9086:Zfp541 UTSW 7 16090404 missense probably damaging 1.00
R9132:Zfp541 UTSW 7 16083041 missense probably benign 0.45
R9261:Zfp541 UTSW 7 16082104 missense possibly damaging 0.94
R9408:Zfp541 UTSW 7 16072214 missense probably damaging 1.00
Z1088:Zfp541 UTSW 7 16079795 missense probably benign 0.16
Z1176:Zfp541 UTSW 7 16078266 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16078763 missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 16079029 missense probably benign 0.26
Z1177:Zfp541 UTSW 7 16082167 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCAGAGTCTCCACGGCTTCAAC -3'
(R):5'- GGACTTGGCAATCATCTGGAGCAC -3'

Sequencing Primer
(F):5'- CGGCTTCAACGGCCATC -3'
(R):5'- GGCTTACTAGAGACTCCTGTGAC -3'
Posted On 2013-11-18