Incidental Mutation 'R1083:Adamts17'
ID 84923
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
Synonyms AU023434
MMRRC Submission 039169-MU
Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R1083 (G1)
Quality Score 165
Status Validated
Chromosome 7
Chromosomal Location 66839735-67153171 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67147574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 986 (C986Y)
Ref Sequence ENSEMBL: ENSMUSP00000103102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
AlphaFold E9Q4D1
Predicted Effect probably damaging
Transcript: ENSMUST00000098382
AA Change: C1013Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: C1013Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107478
AA Change: C986Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: C986Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Meta Mutation Damage Score 0.9651 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66968902 missense probably damaging 1.00
IGL00950:Adamts17 APN 7 67120912 missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66908601 missense probably damaging 1.00
IGL01591:Adamts17 APN 7 67004396 missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66888411 missense probably benign 0.29
IGL01640:Adamts17 APN 7 67029680 missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66840289 missense probably benign 0.06
IGL01747:Adamts17 APN 7 67052011 missense probably damaging 1.00
IGL02081:Adamts17 APN 7 67062110 missense probably damaging 1.00
IGL02152:Adamts17 APN 7 67125000 missense probably benign 0.01
IGL02264:Adamts17 APN 7 67047459 splice site probably null
IGL02457:Adamts17 APN 7 67027814 missense probably damaging 0.99
IGL02519:Adamts17 APN 7 67124973 missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66909376 missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66849878 splice site probably benign
IGL02711:Adamts17 APN 7 67052040 splice site probably benign
IGL03006:Adamts17 APN 7 67078347 missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 67062108 missense probably damaging 1.00
IGL03343:Adamts17 APN 7 67075316 missense probably damaging 1.00
BB007:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
BB017:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
E2594:Adamts17 UTSW 7 67004350 missense probably damaging 1.00
R0380:Adamts17 UTSW 7 67150044 missense probably benign 0.00
R0416:Adamts17 UTSW 7 66915898 splice site probably null
R0635:Adamts17 UTSW 7 66908605 missense probably damaging 1.00
R1476:Adamts17 UTSW 7 67075343 missense probably damaging 1.00
R1728:Adamts17 UTSW 7 67149956 nonsense probably null
R1729:Adamts17 UTSW 7 67149956 nonsense probably null
R1763:Adamts17 UTSW 7 67147715 missense probably damaging 1.00
R1784:Adamts17 UTSW 7 67149956 nonsense probably null
R1905:Adamts17 UTSW 7 67047472 nonsense probably null
R1938:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3106:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66839914 splice site probably null
R3849:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3850:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3945:Adamts17 UTSW 7 67120939 missense probably benign
R4519:Adamts17 UTSW 7 66840566 missense probably damaging 0.99
R4554:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4555:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4556:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4557:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4700:Adamts17 UTSW 7 67041888 missense probably damaging 1.00
R4752:Adamts17 UTSW 7 67004470 missense probably damaging 0.96
R5019:Adamts17 UTSW 7 67062070 nonsense probably null
R5438:Adamts17 UTSW 7 66888417 missense probably benign 0.30
R5444:Adamts17 UTSW 7 67041899 missense probably benign 0.02
R5673:Adamts17 UTSW 7 67041807 missense probably damaging 1.00
R6326:Adamts17 UTSW 7 67120888 missense probably benign 0.05
R6964:Adamts17 UTSW 7 66909400 missense possibly damaging 0.93
R6964:Adamts17 UTSW 7 67004353 missense probably benign 0.00
R7129:Adamts17 UTSW 7 67121010 missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66840556 nonsense probably null
R7355:Adamts17 UTSW 7 67075304 missense
R7386:Adamts17 UTSW 7 66968849 missense probably benign 0.25
R7407:Adamts17 UTSW 7 67047556 nonsense probably null
R7432:Adamts17 UTSW 7 67051917 missense
R7782:Adamts17 UTSW 7 67125054 missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66909476 missense probably damaging 0.99
R7930:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
R7993:Adamts17 UTSW 7 66849864 missense possibly damaging 0.90
R8178:Adamts17 UTSW 7 66849716 missense possibly damaging 0.46
R8962:Adamts17 UTSW 7 67075309 missense probably damaging 1.00
R9095:Adamts17 UTSW 7 67004369 missense probably damaging 1.00
R9111:Adamts17 UTSW 7 66839900 missense probably damaging 0.96
R9303:Adamts17 UTSW 7 66839897 missense probably damaging 0.99
R9305:Adamts17 UTSW 7 66839897 missense probably damaging 0.99
X0022:Adamts17 UTSW 7 67041901 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGCATTCTTTCAGCAGGTAGTGAGC -3'
(R):5'- TTCAGCCCTAGCAAATGTCAGCC -3'

Sequencing Primer
(F):5'- TGAGCATCCTTGACATGCAG -3'
(R):5'- TGCTCAAAGAAGATGGCTTCC -3'
Posted On 2013-11-18