Mutagenetix > Incidental Mutations

Incidental Mutation 'R1083:Adamts17'

84923

Institutional Source

Beutler Lab

Gene Symbol

Adamts17

Ensembl Gene

ENSMUSG00000058145

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17

Synonyms

AU023434

MMRRC Submission

039169-MU

Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1083 (G1)

Quality Score

165

Status

Validated

Chromosome

Chromosomal Location

66839735-67153171 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 67147574 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 986 (C986Y)

Ref Sequence

ENSEMBL: ENSMUSP00000103102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]

AlphaFold

E9Q4D1

Predicted Effect

probably damaging
Transcript: ENSMUST00000098382
AA Change: C1013Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: C1013Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107478
AA Change: C986Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: C986Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Meta Mutation Damage Score

0.9651

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cdh2	T	C	18: 16,643,959	N273S	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Gpam	A	G	19: 55,088,211		probably benign	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Yes1	T	C	5: 32,651,757		probably null	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Adamts17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Adamts17	APN	7	66968902	missense	probably damaging	1.00
IGL00950:Adamts17	APN	7	67120912	missense	possibly damaging	0.69
IGL01532:Adamts17	APN	7	66908601	missense	probably damaging	1.00
IGL01591:Adamts17	APN	7	67004396	missense	probably damaging	1.00
IGL01602:Adamts17	APN	7	66888411	missense	probably benign	0.29
IGL01640:Adamts17	APN	7	67029680	missense	probably damaging	0.98
IGL01686:Adamts17	APN	7	66840289	missense	probably benign	0.06
IGL01747:Adamts17	APN	7	67052011	missense	probably damaging	1.00
IGL02081:Adamts17	APN	7	67062110	missense	probably damaging	1.00
IGL02152:Adamts17	APN	7	67125000	missense	probably benign	0.01
IGL02264:Adamts17	APN	7	67047459	splice site	probably null
IGL02457:Adamts17	APN	7	67027814	missense	probably damaging	0.99
IGL02519:Adamts17	APN	7	67124973	missense	possibly damaging	0.82
IGL02530:Adamts17	APN	7	66909376	missense	probably damaging	1.00
IGL02649:Adamts17	APN	7	66849878	splice site	probably benign
IGL02711:Adamts17	APN	7	67052040	splice site	probably benign
IGL03006:Adamts17	APN	7	67078347	missense	possibly damaging	0.53
IGL03203:Adamts17	APN	7	67062108	missense	probably damaging	1.00
IGL03343:Adamts17	APN	7	67075316	missense	probably damaging	1.00
BB007:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
BB017:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
E2594:Adamts17	UTSW	7	67004350	missense	probably damaging	1.00
R0380:Adamts17	UTSW	7	67150044	missense	probably benign	0.00
R0416:Adamts17	UTSW	7	66915898	splice site	probably null
R0635:Adamts17	UTSW	7	66908605	missense	probably damaging	1.00
R1476:Adamts17	UTSW	7	67075343	missense	probably damaging	1.00
R1728:Adamts17	UTSW	7	67149956	nonsense	probably null
R1729:Adamts17	UTSW	7	67149956	nonsense	probably null
R1763:Adamts17	UTSW	7	67147715	missense	probably damaging	1.00
R1784:Adamts17	UTSW	7	67149956	nonsense	probably null
R1905:Adamts17	UTSW	7	67047472	nonsense	probably null
R1938:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3106:Adamts17	UTSW	7	67125072	missense	probably damaging	1.00
R3796:Adamts17	UTSW	7	66839914	splice site	probably null
R3849:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3850:Adamts17	UTSW	7	66840467	missense	possibly damaging	0.92
R3945:Adamts17	UTSW	7	67120939	missense	probably benign
R4519:Adamts17	UTSW	7	66840566	missense	probably damaging	0.99
R4554:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4555:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4556:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4557:Adamts17	UTSW	7	67027893	missense	probably damaging	1.00
R4700:Adamts17	UTSW	7	67041888	missense	probably damaging	1.00
R4752:Adamts17	UTSW	7	67004470	missense	probably damaging	0.96
R5019:Adamts17	UTSW	7	67062070	nonsense	probably null
R5438:Adamts17	UTSW	7	66888417	missense	probably benign	0.30
R5444:Adamts17	UTSW	7	67041899	missense	probably benign	0.02
R5673:Adamts17	UTSW	7	67041807	missense	probably damaging	1.00
R6326:Adamts17	UTSW	7	67120888	missense	probably benign	0.05
R6964:Adamts17	UTSW	7	66909400	missense	possibly damaging	0.93
R6964:Adamts17	UTSW	7	67004353	missense	probably benign	0.00
R7129:Adamts17	UTSW	7	67121010	missense	probably damaging	1.00
R7317:Adamts17	UTSW	7	66840556	nonsense	probably null
R7355:Adamts17	UTSW	7	67075304	missense
R7386:Adamts17	UTSW	7	66968849	missense	probably benign	0.25
R7407:Adamts17	UTSW	7	67047556	nonsense	probably null
R7432:Adamts17	UTSW	7	67051917	missense
R7782:Adamts17	UTSW	7	67125054	missense	probably damaging	1.00
R7817:Adamts17	UTSW	7	66909476	missense	probably damaging	0.99
R7930:Adamts17	UTSW	7	66849799	missense	probably damaging	0.96
R7993:Adamts17	UTSW	7	66849864	missense	possibly damaging	0.90
R8178:Adamts17	UTSW	7	66849716	missense	possibly damaging	0.46
R8962:Adamts17	UTSW	7	67075309	missense	probably damaging	1.00
R9095:Adamts17	UTSW	7	67004369	missense	probably damaging	1.00
R9111:Adamts17	UTSW	7	66839900	missense	probably damaging	0.96
R9303:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
R9305:Adamts17	UTSW	7	66839897	missense	probably damaging	0.99
X0022:Adamts17	UTSW	7	67041901	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- AGCATTCTTTCAGCAGGTAGTGAGC -3'
(R):5'- TTCAGCCCTAGCAAATGTCAGCC -3'

Sequencing Primer
(F):5'- TGAGCATCCTTGACATGCAG -3'
(R):5'- TGCTCAAAGAAGATGGCTTCC -3'

Posted On

2013-11-18