Incidental Mutation 'R1083:D7Ertd443e'
ID 84924
Institutional Source Beutler Lab
Gene Symbol D7Ertd443e
Ensembl Gene ENSMUSG00000030994
Gene Name DNA segment, Chr 7, ERATO Doi 443, expressed
Synonyms
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 134265779-134385661 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 134348934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 337 (Q337*)
Ref Sequence ENSEMBL: ENSMUSP00000134479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094002] [ENSMUST00000172947] [ENSMUST00000173195] [ENSMUST00000173754] [ENSMUST00000174700]
AlphaFold D2J0Y4
Predicted Effect probably null
Transcript: ENSMUST00000094002
AA Change: Q290*
SMART Domains Protein: ENSMUSP00000091539
Gene: ENSMUSG00000030994
AA Change: Q290*

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Pfam:ALMS_motif 511 644 3.7e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172947
AA Change: Q337*
SMART Domains Protein: ENSMUSP00000134479
Gene: ENSMUSG00000030994
AA Change: Q337*

DomainStartEndE-ValueType
low complexity region 226 239 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 525 541 N/A INTRINSIC
Pfam:ALMS_motif 559 689 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173195
Predicted Effect probably benign
Transcript: ENSMUST00000173754
Predicted Effect probably benign
Transcript: ENSMUST00000174700
SMART Domains Protein: ENSMUSP00000134411
Gene: ENSMUSG00000030994

DomainStartEndE-ValueType
Pfam:ALMS_motif 25 98 2.3e-12 PFAM
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in D7Ertd443e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:D7Ertd443e APN 7 134349400 missense possibly damaging 0.56
R0369:D7Ertd443e UTSW 7 134298137 missense possibly damaging 0.56
R0501:D7Ertd443e UTSW 7 134294972 missense probably damaging 1.00
R1073:D7Ertd443e UTSW 7 134270218 missense probably damaging 1.00
R1744:D7Ertd443e UTSW 7 134349413 missense probably benign 0.00
R1801:D7Ertd443e UTSW 7 134270212 missense probably damaging 1.00
R1807:D7Ertd443e UTSW 7 134293305 missense probably null 1.00
R2050:D7Ertd443e UTSW 7 134266798 missense probably damaging 1.00
R2273:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2274:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R2504:D7Ertd443e UTSW 7 134349479 splice site probably null
R3699:D7Ertd443e UTSW 7 134349068 missense probably damaging 1.00
R4348:D7Ertd443e UTSW 7 134348953 frame shift probably null
R4516:D7Ertd443e UTSW 7 134293328 missense probably damaging 1.00
R5123:D7Ertd443e UTSW 7 134349668 splice site probably null
R5440:D7Ertd443e UTSW 7 134349275 missense probably damaging 0.96
R5555:D7Ertd443e UTSW 7 134349591 missense probably benign 0.00
R5711:D7Ertd443e UTSW 7 134349381 missense probably benign 0.43
R5848:D7Ertd443e UTSW 7 134349722 missense possibly damaging 0.92
R6049:D7Ertd443e UTSW 7 134298232 missense probably benign 0.01
R6266:D7Ertd443e UTSW 7 134349785 missense probably damaging 1.00
R6408:D7Ertd443e UTSW 7 134349711 missense probably benign 0.27
R6939:D7Ertd443e UTSW 7 134364479 splice site probably null
R7195:D7Ertd443e UTSW 7 134295122 missense probably damaging 1.00
R7352:D7Ertd443e UTSW 7 134349394 missense probably benign 0.03
R7737:D7Ertd443e UTSW 7 134270201 missense probably damaging 1.00
R7843:D7Ertd443e UTSW 7 134349095 missense possibly damaging 0.93
R7845:D7Ertd443e UTSW 7 134270248 missense probably damaging 1.00
R8346:D7Ertd443e UTSW 7 134348756 missense possibly damaging 0.63
R9120:D7Ertd443e UTSW 7 134270257 missense probably damaging 1.00
R9166:D7Ertd443e UTSW 7 134298319 missense probably benign 0.01
Z1088:D7Ertd443e UTSW 7 134294982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAACTCCAGCCGGGAATATGGATG -3'
(R):5'- GGGTCACCCACACGAATGACAATG -3'

Sequencing Primer
(F):5'- CCGGGAATATGGATGGAGAGTTG -3'
(R):5'- GTCTCAGCAGTGTCCCAATG -3'
Posted On 2013-11-18