Incidental Mutation 'R1083:Map10'
ID84926
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Namemicrotubule-associated protein 10
Synonyms4933403G14Rik
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1083 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125669818-125673359 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 125670439 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 190 (C190*)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
Predicted Effect probably null
Transcript: ENSMUST00000053078
AA Change: C190*
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: C190*

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125671932 missense probably benign 0.00
IGL01567:Map10 APN 8 125671493 missense probably benign 0.32
IGL02566:Map10 APN 8 125671755 missense probably benign
IGL03088:Map10 APN 8 125671070 missense probably benign 0.14
debauched UTSW 8 125671245 missense probably damaging 1.00
R1543:Map10 UTSW 8 125670872 missense probably benign 0.00
R3155:Map10 UTSW 8 125671574 missense possibly damaging 0.79
R4076:Map10 UTSW 8 125671845 missense probably benign 0.23
R4559:Map10 UTSW 8 125671814 missense probably benign
R4856:Map10 UTSW 8 125670692 missense probably damaging 1.00
R4886:Map10 UTSW 8 125670692 missense probably damaging 1.00
R5412:Map10 UTSW 8 125670985 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6150:Map10 UTSW 8 125671589 missense probably damaging 0.96
R6351:Map10 UTSW 8 125671245 missense probably damaging 1.00
R6466:Map10 UTSW 8 125672384 nonsense probably null
R6544:Map10 UTSW 8 125671374 missense probably benign 0.00
R6557:Map10 UTSW 8 125670252 missense probably damaging 0.98
R6821:Map10 UTSW 8 125670399 missense probably benign 0.01
R7096:Map10 UTSW 8 125671923 missense probably damaging 0.99
R7128:Map10 UTSW 8 125671853 missense probably benign
R7177:Map10 UTSW 8 125671845 missense probably benign 0.23
R7237:Map10 UTSW 8 125671224 missense probably benign 0.03
R7814:Map10 UTSW 8 125671611 missense probably benign 0.14
R7819:Map10 UTSW 8 125670521 frame shift probably null
R8202:Map10 UTSW 8 125670908 missense possibly damaging 0.95
R8812:Map10 UTSW 8 125669925 missense probably damaging 0.99
R8859:Map10 UTSW 8 125670552 missense probably benign 0.04
Z1088:Map10 UTSW 8 125671931 frame shift probably null
Z1177:Map10 UTSW 8 125670070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTATCGCCTGACCGAACTGG -3'
(R):5'- CCTGGCTGAAGGAGTCTTTTCCTG -3'

Sequencing Primer
(F):5'- CCGAACTGGGACGCTTTTC -3'
(R):5'- TGTGACATCCTGACTGACAG -3'
Posted On2013-11-18