Incidental Mutation 'R1083:Dixdc1'
ID 84928
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene Name DIX domain containing 1
Synonyms 4930563F16Rik, Ccd1
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1083 (G1)
Quality Score 193
Status Validated
Chromosome 9
Chromosomal Location 50662752-50739517 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 50676993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117646] [ENSMUST00000120622] [ENSMUST00000121634]
AlphaFold Q80Y83
Predicted Effect probably benign
Transcript: ENSMUST00000034566
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117646
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119449
Predicted Effect probably benign
Transcript: ENSMUST00000120622
SMART Domains Protein: ENSMUSP00000113934
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
coiled coil region 34 66 N/A INTRINSIC
coiled coil region 87 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121634
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141919
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50667733 missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50706134 missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50695503 missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50703258 nonsense probably null
IGL02074:Dixdc1 APN 9 50702017 missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50682631 splice site probably benign
R0230:Dixdc1 UTSW 9 50695507 missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50693674 missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50684853 missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50703246 missense probably benign 0.02
R1672:Dixdc1 UTSW 9 50689864 missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50682550 missense probably benign
R2213:Dixdc1 UTSW 9 50701945 missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50683872 critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R2940:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R3081:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R4982:Dixdc1 UTSW 9 50682602 missense possibly damaging 0.89
R5250:Dixdc1 UTSW 9 50683735 missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50669480 missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50698588 intron probably benign
R6228:Dixdc1 UTSW 9 50703356 splice site probably null
R6346:Dixdc1 UTSW 9 50683953 missense probably damaging 1.00
R6370:Dixdc1 UTSW 9 50682223 splice site probably null
R7036:Dixdc1 UTSW 9 50682564 missense probably benign 0.03
R7074:Dixdc1 UTSW 9 50689914 missense possibly damaging 0.83
R7361:Dixdc1 UTSW 9 50688653 missense probably damaging 0.99
R7734:Dixdc1 UTSW 9 50701968 missense probably damaging 1.00
R8292:Dixdc1 UTSW 9 50710689 missense probably benign 0.03
R8318:Dixdc1 UTSW 9 50684409 critical splice acceptor site probably null
R8353:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8453:Dixdc1 UTSW 9 50684886 missense probably benign 0.24
R8462:Dixdc1 UTSW 9 50710779 nonsense probably null
R8810:Dixdc1 UTSW 9 50701965 missense probably damaging 1.00
R8871:Dixdc1 UTSW 9 50683796 missense possibly damaging 0.89
R8872:Dixdc1 UTSW 9 50703153 missense possibly damaging 0.77
RF016:Dixdc1 UTSW 9 50693641 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCCCCGGAACTGACAGA -3'
(R):5'- CATGTGCCTCACCTCATTAAATCCAAGA -3'

Sequencing Primer
(F):5'- TGGACTAGAATGTCACCTGC -3'
(R):5'- TTAAATCCAAGAACCTGGGCAAG -3'
Posted On 2013-11-18