Incidental Mutation 'R1083:Gm5174'
ID 84931
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Name predicted gene 5174
Synonyms
MMRRC Submission 039169-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86655939-86657381 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 86656108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
AA Change: V57A
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308
AA Change: V57A

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Meta Mutation Damage Score 0.1915 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86656108 unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86657325 unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86657002 unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86656912 unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86656753 unclassified noncoding transcript
R2221:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R2223:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86656655 unclassified noncoding transcript
R4165:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4243:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86656587 unclassified noncoding transcript
R5292:Gm5174 UTSW 10 86656698 unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86656545 unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86657181 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTCCATACAGAGCAGGGAGCTAC -3'
(R):5'- CTTGACAGAGGCCACTAATTGTCCG -3'

Sequencing Primer
(F):5'- CAACTTGTGTGTACCAGAGC -3'
(R):5'- CTCCAGTATGAAGTTGACGCAG -3'
Posted On 2013-11-18