Incidental Mutation 'R1083:Ccer1'
ID84932
Institutional Source Beutler Lab
Gene Symbol Ccer1
Ensembl Gene ENSMUSG00000047025
Gene Namecoiled-coil glutamate-rich protein 1
Synonyms
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1083 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location97693059-97694923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97694658 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 394 (D394E)
Ref Sequence ENSEMBL: ENSMUSP00000050554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060703
AA Change: D394E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050554
Gene: ENSMUSG00000047025
AA Change: D394E

DomainStartEndE-ValueType
Pfam:CCER1 4 218 5.9e-123 PFAM
coiled coil region 292 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220233
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sfmbt1 A T 14: 30,787,541 N326Y possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Ccer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Ccer1 APN 10 97694539 missense probably benign 0.18
IGL01434:Ccer1 APN 10 97693597 missense unknown
IGL01895:Ccer1 APN 10 97694050 missense unknown
IGL02030:Ccer1 APN 10 97693610 missense unknown
IGL02962:Ccer1 APN 10 97693840 missense unknown
IGL03352:Ccer1 APN 10 97693577 missense unknown
R1911:Ccer1 UTSW 10 97694677 missense possibly damaging 0.53
R3769:Ccer1 UTSW 10 97694552 missense probably damaging 1.00
R4364:Ccer1 UTSW 10 97694370 small deletion probably benign
R5737:Ccer1 UTSW 10 97694684 missense possibly damaging 0.53
R7154:Ccer1 UTSW 10 97694339 missense unknown
R7173:Ccer1 UTSW 10 97693355 start gained probably benign
R7413:Ccer1 UTSW 10 97693942 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTCTAATGCAGCACAACCAGTC -3'
(R):5'- TCTGTGGATTTCAAGCTCAGAAACCTG -3'

Sequencing Primer
(F):5'- aggaggaggaggaggagg -3'
(R):5'- AGCTCAGAAACCTGCTGTG -3'
Posted On2013-11-18