Incidental Mutation 'R1083:Sfmbt1'
ID 84933
Institutional Source Beutler Lab
Gene Symbol Sfmbt1
Ensembl Gene ENSMUSG00000006527
Gene Name Scm-like with four mbt domains 1
Synonyms 4930442N21Rik, 9330180L21Rik, Smr
MMRRC Submission 039169-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock # R1083 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 30714849-30822721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30787541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 326 (N326Y)
Ref Sequence ENSEMBL: ENSMUSP00000153962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054230] [ENSMUST00000112184] [ENSMUST00000227201] [ENSMUST00000227303] [ENSMUST00000228006]
AlphaFold Q9JMD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000054230
AA Change: N326Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056744
Gene: ENSMUSG00000006527
AA Change: N326Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112177
AA Change: N326Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107799
Gene: ENSMUSG00000006527
AA Change: N326Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 6.7e-43 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112184
AA Change: N326Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107802
Gene: ENSMUSG00000006527
AA Change: N326Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 499 614 3.1e-41 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 693 749 N/A INTRINSIC
SAM 790 856 1.12e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131706
AA Change: N326Y

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117866
Gene: ENSMUSG00000006527
AA Change: N326Y

DomainStartEndE-ValueType
MBT 20 120 2.04e-40 SMART
MBT 128 232 4.22e-33 SMART
MBT 242 346 4.42e-36 SMART
MBT 354 451 7.06e-44 SMART
Pfam:DUF3588 498 617 7.3e-43 PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000227201
AA Change: N326Y

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227303
AA Change: N326Y

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228006
AA Change: N326Y

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares high similarity with the Drosophila Scm (sex comb on midleg) gene. It encodes a protein which contains four malignant brain tumor repeat (mbt) domains and may be involved in antigen recognition. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T C 6: 92,828,065 probably benign Het
Adamts17 G A 7: 67,147,574 C986Y probably damaging Het
AI987944 A G 7: 41,375,339 V75A probably benign Het
Arhgap10 T C 8: 77,517,749 Y12C probably damaging Het
Atp11b G A 3: 35,778,013 probably benign Het
Ccer1 T A 10: 97,694,658 D394E possibly damaging Het
Cdh2 T C 18: 16,643,959 N273S possibly damaging Het
Cfap65 G T 1: 74,918,504 probably benign Het
Crybb3 A T 5: 113,080,578 probably benign Het
D7Ertd443e G A 7: 134,348,934 Q337* probably null Het
Dixdc1 C T 9: 50,676,993 probably benign Het
Dut GCGGC GCGGCCGGC 2: 125,247,828 probably null Het
Fbxo2 A G 4: 148,165,777 probably null Het
Gm5174 T C 10: 86,656,108 noncoding transcript Het
Gpam A G 19: 55,088,211 probably benign Het
Il12a C T 3: 68,695,333 T112M probably damaging Het
Itpr1 T A 6: 108,510,696 V2361D possibly damaging Het
Jag1 G A 2: 137,096,232 L283F probably damaging Het
Lamb2 A C 9: 108,483,693 D538A probably benign Het
Map10 T A 8: 125,670,439 C190* probably null Het
Pcnx2 C T 8: 125,772,104 R1552H probably damaging Het
Phf1 T C 17: 26,937,270 probably benign Het
Pitx2 A G 3: 129,218,769 T276A probably damaging Het
Pparg A G 6: 115,490,146 D490G probably damaging Het
Rnf10 A T 5: 115,260,104 probably benign Het
Sbp T C 17: 23,942,730 probably benign Het
Setbp1 A T 18: 78,857,626 L942H probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slx4 G A 16: 3,990,910 Q389* probably null Het
Srrm3 T A 5: 135,854,409 V206E probably damaging Het
Sspo T A 6: 48,470,999 D2270E possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Vmn1r14 T A 6: 57,234,199 I210N probably damaging Het
Wasf3 T G 5: 146,435,372 L13R probably damaging Het
Yes1 T C 5: 32,651,757 probably null Het
Zfp292 T C 4: 34,807,569 D1830G probably damaging Het
Zfp541 A G 7: 16,078,712 N430S probably benign Het
Other mutations in Sfmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Sfmbt1 APN 14 30810311 missense probably damaging 1.00
IGL01351:Sfmbt1 APN 14 30769820 missense probably benign 0.00
IGL01478:Sfmbt1 APN 14 30811521 missense probably damaging 1.00
IGL01632:Sfmbt1 APN 14 30817712 missense probably damaging 1.00
IGL02252:Sfmbt1 APN 14 30817733 missense probably damaging 1.00
IGL02456:Sfmbt1 APN 14 30785880 missense probably damaging 0.99
IGL02651:Sfmbt1 APN 14 30815537 missense probably damaging 1.00
IGL02967:Sfmbt1 APN 14 30816802 missense probably damaging 1.00
PIT4142001:Sfmbt1 UTSW 14 30816757 splice site probably null
PIT4519001:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
PIT4531001:Sfmbt1 UTSW 14 30796326 missense probably benign 0.00
R0043:Sfmbt1 UTSW 14 30816807 missense probably damaging 0.99
R0389:Sfmbt1 UTSW 14 30811507 missense probably damaging 1.00
R0395:Sfmbt1 UTSW 14 30787617 splice site probably benign
R0562:Sfmbt1 UTSW 14 30811373 splice site probably null
R1900:Sfmbt1 UTSW 14 30802567 missense probably damaging 1.00
R2447:Sfmbt1 UTSW 14 30773893 missense possibly damaging 0.62
R3104:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3105:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R3106:Sfmbt1 UTSW 14 30817796 missense probably damaging 1.00
R4038:Sfmbt1 UTSW 14 30787492 missense probably damaging 1.00
R5118:Sfmbt1 UTSW 14 30790770 missense probably damaging 1.00
R5227:Sfmbt1 UTSW 14 30815254 critical splice donor site probably null
R5286:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5287:Sfmbt1 UTSW 14 30816820 missense probably damaging 1.00
R5295:Sfmbt1 UTSW 14 30774029 missense probably damaging 1.00
R5620:Sfmbt1 UTSW 14 30784191 critical splice donor site probably null
R6113:Sfmbt1 UTSW 14 30815184 missense possibly damaging 0.68
R6139:Sfmbt1 UTSW 14 30811418 missense probably damaging 1.00
R6429:Sfmbt1 UTSW 14 30773911 missense probably damaging 1.00
R6657:Sfmbt1 UTSW 14 30766096 missense possibly damaging 0.50
R6955:Sfmbt1 UTSW 14 30766034 start gained probably benign
R6957:Sfmbt1 UTSW 14 30787589 missense probably benign 0.00
R7206:Sfmbt1 UTSW 14 30811373 splice site probably null
R7337:Sfmbt1 UTSW 14 30784739 missense possibly damaging 0.62
R7451:Sfmbt1 UTSW 14 30816811 missense probably benign 0.02
R7684:Sfmbt1 UTSW 14 30810354 missense probably damaging 1.00
R7798:Sfmbt1 UTSW 14 30816802 missense probably damaging 1.00
R7983:Sfmbt1 UTSW 14 30797716 splice site probably null
R8468:Sfmbt1 UTSW 14 30773984 missense probably benign
R9342:Sfmbt1 UTSW 14 30797642 missense possibly damaging 0.94
X0064:Sfmbt1 UTSW 14 30815205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAGTTGACCCCTTGCTAAGC -3'
(R):5'- ACTCTGCTACACAGTGAGACCCTAC -3'

Sequencing Primer
(F):5'- tgaaaatggcacctccctc -3'
(R):5'- AGTGAGACCCTACACAATTAATAATG -3'
Posted On 2013-11-18