Mutagenetix > Incidental Mutation

Incidental Mutation 'R1083:Cdh2'

84937

Institutional Source

Beutler Lab

Gene Symbol

Cdh2

Ensembl Gene

ENSMUSG00000024304

Gene Name

cadherin 2

Synonyms

Ncad, N-cadherin

MMRRC Submission

039169-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16588877-16809246 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16643959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 273 (N273S)

Ref Sequence

ENSEMBL: ENSMUSP00000025166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]

AlphaFold

P15116

PDB Structure

STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
STRUCTURAL BASIS OF CELL-CELL ADHESION BY CADHERINS [X-RAY DIFFRACTION]
N-CADHERIN, TWO-DOMAIN FRAGMENT [X-RAY DIFFRACTION]
Solution Structure of Neural Cadherin Prodomain [SOLUTION NMR]
Crystal structure of N-cadherin domains EC12 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin ectodomain [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 A78SI92M [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 with AA insertion between residues 2 and 3 [X-RAY DIFFRACTION]
Crystal structure of mouse N-cadherin EC1-2 W2F [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025166
AA Change: N273S

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304
AA Change: N273S

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Cadherin_pro	31	123	5.77e-34	SMART
low complexity region	129	141	N/A	INTRINSIC
CA	182	265	3.37e-17	SMART
CA	289	380	2.15e-33	SMART
CA	403	496	4.38e-16	SMART
CA	519	603	2.27e-23	SMART
CA	623	708	5.54e-2	SMART
transmembrane domain	724	746	N/A	INTRINSIC
Pfam:Cadherin_C	753	903	6.3e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115850
AA Change: N216S

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304
AA Change: N216S

Domain	Start	End	E-Value	Type
Cadherin_pro	1	66	3.44e-9	SMART
low complexity region	72	84	N/A	INTRINSIC
CA	125	208	3.37e-17	SMART
CA	232	323	2.15e-33	SMART
CA	346	439	4.38e-16	SMART
CA	462	546	2.27e-23	SMART
CA	566	651	5.54e-2	SMART
transmembrane domain	667	689	N/A	INTRINSIC
Pfam:Cadherin_C	690	847	2.5e-57	PFAM

Meta Mutation Damage Score

0.1121

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
Adamts17	G	A	7: 67,147,574	C986Y	probably damaging	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Gpam	A	G	19: 55,088,211		probably benign	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Yes1	T	C	5: 32,651,757		probably null	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Cdh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Cdh2	APN	18	16627636	missense	possibly damaging	0.69
IGL01560:Cdh2	APN	18	16650438	missense	probably benign	0.01
IGL02028:Cdh2	APN	18	16650420	missense	probably benign	0.07
IGL02227:Cdh2	APN	18	16629586	missense	probably benign	0.01
IGL02229:Cdh2	APN	18	16624753	missense	probably benign
IGL02617:Cdh2	APN	18	16627604	missense	probably damaging	1.00
IGL02685:Cdh2	APN	18	16646500	missense	probably damaging	1.00
IGL02724:Cdh2	APN	18	16629480	missense	probably benign	0.29
R0111:Cdh2	UTSW	18	16774509	missense	probably benign
R0173:Cdh2	UTSW	18	16650257	splice site	probably benign
R0197:Cdh2	UTSW	18	16629576	missense	probably benign
R0563:Cdh2	UTSW	18	16629681	missense	possibly damaging	0.90
R0883:Cdh2	UTSW	18	16629576	missense	probably benign
R1270:Cdh2	UTSW	18	16627557	splice site	probably benign
R1469:Cdh2	UTSW	18	16624267	missense	possibly damaging	0.92
R1469:Cdh2	UTSW	18	16624267	missense	possibly damaging	0.92
R1510:Cdh2	UTSW	18	16648594	missense	probably benign
R1875:Cdh2	UTSW	18	16624877	missense	probably benign
R2122:Cdh2	UTSW	18	16774543	missense	probably benign	0.01
R2194:Cdh2	UTSW	18	16640448	missense	probably damaging	1.00
R2254:Cdh2	UTSW	18	16643928	critical splice donor site	probably null
R4471:Cdh2	UTSW	18	16774476	splice site	probably null
R4501:Cdh2	UTSW	18	16629585	missense	possibly damaging	0.53
R4620:Cdh2	UTSW	18	16648608	missense	probably benign
R4832:Cdh2	UTSW	18	16627697	missense	probably benign	0.01
R4944:Cdh2	UTSW	18	16650409	missense	probably damaging	0.99
R4958:Cdh2	UTSW	18	16627565	splice site	probably null
R5160:Cdh2	UTSW	18	16629587	missense	probably damaging	0.99
R5190:Cdh2	UTSW	18	16650315	missense	possibly damaging	0.54
R5446:Cdh2	UTSW	18	16646627	missense	probably damaging	1.00
R5552:Cdh2	UTSW	18	16640463	missense	possibly damaging	0.88
R5699:Cdh2	UTSW	18	16646522	nonsense	probably null
R5912:Cdh2	UTSW	18	16640450	missense	possibly damaging	0.79
R5949:Cdh2	UTSW	18	16601630	missense	probably damaging	1.00
R6313:Cdh2	UTSW	18	16774522	missense	probably benign	0.00
R6633:Cdh2	UTSW	18	16640548	missense	probably benign	0.00
R7822:Cdh2	UTSW	18	16624284	missense	probably benign	0.24
R8022:Cdh2	UTSW	18	16590301	missense	probably damaging	1.00
R8142:Cdh2	UTSW	18	16601734	missense	probably benign	0.00
R8152:Cdh2	UTSW	18	16629519	missense	probably benign	0.02
R8188:Cdh2	UTSW	18	16648536	missense	probably damaging	1.00
R8461:Cdh2	UTSW	18	16650465	missense	probably benign	0.44
R8491:Cdh2	UTSW	18	16624718	critical splice donor site	probably null
R9246:Cdh2	UTSW	18	16648597	nonsense	probably null
R9477:Cdh2	UTSW	18	16622155	missense	probably damaging	1.00
R9530:Cdh2	UTSW	18	16650409	missense	probably damaging	0.99
R9581:Cdh2	UTSW	18	16670055	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTTCCTTTTGTTCCAAAAGCATAGCC -3'
(R):5'- ACAGATCTTCAAGTGCCTCTGCCC -3'

Sequencing Primer
(F):5'- ttccccctccagaccac -3'
(R):5'- GTGCCTCTGCCCTCTGG -3'

Posted On

2013-11-18