Mutagenetix > Incidental Mutations

Incidental Mutation 'R1083:Gpam'

84939

Institutional Source

Beutler Lab

Gene Symbol

Gpam

Ensembl Gene

ENSMUSG00000024978

Gene Name

glycerol-3-phosphate acyltransferase, mitochondrial

Synonyms

GPAT1

MMRRC Submission

039169-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.282) question?

Stock #

R1083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55069734-55099451 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 55088211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000057635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061856]

AlphaFold

Q61586

Predicted Effect

probably benign
Transcript: ENSMUST00000061856

SMART Domains

Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978

Domain	Start	End	E-Value	Type
Blast:PlsC	5	34	3e-8	BLAST
PlsC	224	357	2.46e-23	SMART
Blast:PlsC	499	551	8e-27	BLAST
low complexity region	687	699	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 94.0%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	C	6: 92,828,065		probably benign	Het
Adamts17	G	A	7: 67,147,574	C986Y	probably damaging	Het
AI987944	A	G	7: 41,375,339	V75A	probably benign	Het
Arhgap10	T	C	8: 77,517,749	Y12C	probably damaging	Het
Atp11b	G	A	3: 35,778,013		probably benign	Het
Ccer1	T	A	10: 97,694,658	D394E	possibly damaging	Het
Cdh2	T	C	18: 16,643,959	N273S	possibly damaging	Het
Cfap65	G	T	1: 74,918,504		probably benign	Het
Crybb3	A	T	5: 113,080,578		probably benign	Het
D7Ertd443e	G	A	7: 134,348,934	Q337*	probably null	Het
Dixdc1	C	T	9: 50,676,993		probably benign	Het
Dut	GCGGC	GCGGCCGGC	2: 125,247,828		probably null	Het
Fbxo2	A	G	4: 148,165,777		probably null	Het
Gm5174	T	C	10: 86,656,108		noncoding transcript	Het
Il12a	C	T	3: 68,695,333	T112M	probably damaging	Het
Itpr1	T	A	6: 108,510,696	V2361D	possibly damaging	Het
Jag1	G	A	2: 137,096,232	L283F	probably damaging	Het
Lamb2	A	C	9: 108,483,693	D538A	probably benign	Het
Map10	T	A	8: 125,670,439	C190*	probably null	Het
Pcnx2	C	T	8: 125,772,104	R1552H	probably damaging	Het
Phf1	T	C	17: 26,937,270		probably benign	Het
Pitx2	A	G	3: 129,218,769	T276A	probably damaging	Het
Pparg	A	G	6: 115,490,146	D490G	probably damaging	Het
Rnf10	A	T	5: 115,260,104		probably benign	Het
Sbp	T	C	17: 23,942,730		probably benign	Het
Setbp1	A	T	18: 78,857,626	L942H	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sfmbt1	A	T	14: 30,787,541	N326Y	possibly damaging	Het
Slx4	G	A	16: 3,990,910	Q389*	probably null	Het
Srrm3	T	A	5: 135,854,409	V206E	probably damaging	Het
Sspo	T	A	6: 48,470,999	D2270E	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Vmn1r14	T	A	6: 57,234,199	I210N	probably damaging	Het
Wasf3	T	G	5: 146,435,372	L13R	probably damaging	Het
Yes1	T	C	5: 32,651,757		probably null	Het
Zfp292	T	C	4: 34,807,569	D1830G	probably damaging	Het
Zfp541	A	G	7: 16,078,712	N430S	probably benign	Het

Other mutations in Gpam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Gpam	APN	19	55078332	missense	possibly damaging	0.71
IGL01349:Gpam	APN	19	55096119	critical splice donor site	probably null
IGL01515:Gpam	APN	19	55087451	missense	probably damaging	1.00
IGL01650:Gpam	APN	19	55081700	missense	probably benign	0.02
IGL01768:Gpam	APN	19	55087520	missense	probably benign	0.00
IGL01809:Gpam	APN	19	55075625	nonsense	probably null
IGL01878:Gpam	APN	19	55083374	missense	probably benign	0.22
IGL02451:Gpam	APN	19	55088203	missense	probably damaging	1.00
IGL03293:Gpam	APN	19	55071016	missense	probably benign
IGL03391:Gpam	APN	19	55081696	missense	probably damaging	1.00
R0492:Gpam	UTSW	19	55096179	missense	possibly damaging	0.72
R0703:Gpam	UTSW	19	55072756	missense	probably benign	0.00
R1432:Gpam	UTSW	19	55079261	missense	probably damaging	0.99
R1457:Gpam	UTSW	19	55088176	missense	probably damaging	1.00
R1556:Gpam	UTSW	19	55076331	missense	possibly damaging	0.94
R1733:Gpam	UTSW	19	55081469	missense	probably damaging	0.99
R1744:Gpam	UTSW	19	55074591	missense	probably damaging	1.00
R1776:Gpam	UTSW	19	55078575	missense	possibly damaging	0.88
R2267:Gpam	UTSW	19	55072710	critical splice donor site	probably null
R2697:Gpam	UTSW	19	55083209	missense	probably damaging	1.00
R3836:Gpam	UTSW	19	55080458	missense	probably benign
R3837:Gpam	UTSW	19	55080458	missense	probably benign
R3838:Gpam	UTSW	19	55080458	missense	probably benign
R3839:Gpam	UTSW	19	55080458	missense	probably benign
R4670:Gpam	UTSW	19	55096119	critical splice donor site	probably null
R4717:Gpam	UTSW	19	55075614	missense	probably benign	0.00
R4819:Gpam	UTSW	19	55078341	missense	probably benign	0.03
R5104:Gpam	UTSW	19	55093986	missense	probably benign	0.44
R5146:Gpam	UTSW	19	55093946	missense	probably damaging	1.00
R5183:Gpam	UTSW	19	55083227	missense	probably damaging	1.00
R5326:Gpam	UTSW	19	55091165	missense	probably benign	0.05
R5347:Gpam	UTSW	19	55088837	missense	probably damaging	1.00
R5621:Gpam	UTSW	19	55079260	missense	probably damaging	1.00
R5644:Gpam	UTSW	19	55088899	missense	probably benign	0.00
R6244:Gpam	UTSW	19	55070985	missense	probably damaging	1.00
R6260:Gpam	UTSW	19	55083406	missense	probably benign	0.40
R6965:Gpam	UTSW	19	55074609	missense	probably damaging	1.00
R7125:Gpam	UTSW	19	55076335	missense	probably benign
R7567:Gpam	UTSW	19	55081630	missense	possibly damaging	0.86
R7715:Gpam	UTSW	19	55088921	missense	probably benign	0.19
R7719:Gpam	UTSW	19	55081670	missense	probably damaging	1.00
R7863:Gpam	UTSW	19	55070956	missense	probably damaging	1.00
R8187:Gpam	UTSW	19	55077837	missense	probably benign
R8434:Gpam	UTSW	19	55081631	missense	possibly damaging	0.93
R8483:Gpam	UTSW	19	55088942	missense	probably damaging	0.99
R8510:Gpam	UTSW	19	55080382	critical splice donor site	probably null
R8537:Gpam	UTSW	19	55096239	missense	probably benign	0.02
R8841:Gpam	UTSW	19	55078518	missense	probably damaging	1.00
R8915:Gpam	UTSW	19	55088880	missense	probably benign
R8987:Gpam	UTSW	19	55083795	missense	possibly damaging	0.79
R9224:Gpam	UTSW	19	55087475	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTCTGAACAAGCTCCAGCAGTG -3'
(R):5'- CAGCAGAGACTTCTGTGAGTGGTG -3'

Sequencing Primer
(F):5'- CGCCACACACGGGAGAC -3'
(R):5'- TGCTTTAAGTCCATATGCCCAG -3'

Posted On

2013-11-18