Incidental Mutation 'R1084:Cyp4b1'
ID84948
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115640312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 163 (V163A)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably benign
Transcript: ENSMUST00000102707
AA Change: V163A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: V163A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135569
AA Change: V39A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143237
Predicted Effect unknown
Transcript: ENSMUST00000145841
AA Change: V73A
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: V73A

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0143:Cyp4b1 UTSW 4 115635874 missense probably damaging 0.99
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0725:Cyp4b1 UTSW 4 115626827 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2279:Cyp4b1 UTSW 4 115640360 missense probably benign 0.23
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R2885:Cyp4b1 UTSW 4 115635652 missense probably damaging 1.00
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
R7584:Cyp4b1 UTSW 4 115628687 missense probably damaging 0.98
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTGGATGCCTCCACAGCATAC -3'
(R):5'- CACTGTGCCTTCTTAACCCAAGGTC -3'

Sequencing Primer
(F):5'- TTAGGCACCATTGCTACAGG -3'
(R):5'- CTCCATGTTGGATACTAGCAGACTG -3'
Posted On2013-11-18