Incidental Mutation 'R1084:Glcci1'
ID84952
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Nameglucocorticoid induced transcript 1
SynonymsFam117c, GIG18, Tssn1
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location8509600-8597548 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 8573221 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 50 (Q50*)
Ref Sequence ENSEMBL: ENSMUSP00000125079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162383] [ENSMUST00000162564] [ENSMUST00000162567]
Predicted Effect probably null
Transcript: ENSMUST00000064285
AA Change: Q237*
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: Q237*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161217
AA Change: Q49*
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638
AA Change: Q49*

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161494
AA Change: Q50*
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638
AA Change: Q50*

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162383
AA Change: Q49*
SMART Domains Protein: ENSMUSP00000125260
Gene: ENSMUSG00000029638
AA Change: Q49*

DomainStartEndE-ValueType
Pfam:FAM117 1 94 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Predicted Effect probably null
Transcript: ENSMUST00000162567
AA Change: Q50*
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638
AA Change: Q50*

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8579596 missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8558581 missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8582757 missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8579678 missense probably damaging 1.00
R1289:Glcci1 UTSW 6 8593088 missense possibly damaging 0.70
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8591620 missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8537837 missense probably benign 0.06
R1982:Glcci1 UTSW 6 8592980 missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8582590 missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8558566 missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8582601 nonsense probably null
R5166:Glcci1 UTSW 6 8537854 missense probably benign 0.23
R5390:Glcci1 UTSW 6 8537835 missense probably benign 0.01
R6351:Glcci1 UTSW 6 8573203 nonsense probably null
X0065:Glcci1 UTSW 6 8591636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTACCACACCATATAAAGTTGCAGA -3'
(R):5'- GGTGACACTCAGAGGGAGGCTC -3'

Sequencing Primer
(F):5'- GCAGAAATGAAGCATTTGTTCC -3'
(R):5'- gagaagggaaagggagaatgg -3'
Posted On2013-11-18