Incidental Mutation 'R1084:Ocel1'
ID84956
Institutional Source Beutler Lab
Gene Symbol Ocel1
Ensembl Gene ENSMUSG00000002396
Gene Nameoccludin/ELL domain containing 1
Synonyms
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71371298-71379361 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) G to T at 71371988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002466] [ENSMUST00000002469] [ENSMUST00000019169] [ENSMUST00000110051] [ENSMUST00000110052] [ENSMUST00000110053] [ENSMUST00000110054] [ENSMUST00000137058] [ENSMUST00000139541]
Predicted Effect probably benign
Transcript: ENSMUST00000002466
SMART Domains Protein: ENSMUSP00000002466
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
ZnF_C4 54 125 1.48e-38 SMART
low complexity region 173 185 N/A INTRINSIC
HOLI 191 351 1.07e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000002469
SMART Domains Protein: ENSMUSP00000002469
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Pfam:Occludin_ELL 106 207 8.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019169
SMART Domains Protein: ENSMUSP00000019169
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110051
SMART Domains Protein: ENSMUSP00000105678
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110052
SMART Domains Protein: ENSMUSP00000105679
Gene: ENSMUSG00000002396

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
low complexity region 29 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110053
SMART Domains Protein: ENSMUSP00000105680
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 30 280 4.6e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110054
SMART Domains Protein: ENSMUSP00000105681
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 266 9.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124732
SMART Domains Protein: ENSMUSP00000116498
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
ZnF_C4 38 80 4.35e-4 SMART
low complexity region 128 140 N/A INTRINSIC
HOLI 146 254 2.72e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136368
Predicted Effect probably benign
Transcript: ENSMUST00000137058
SMART Domains Protein: ENSMUSP00000121648
Gene: ENSMUSG00000002393

DomainStartEndE-ValueType
low complexity region 39 62 N/A INTRINSIC
ZnF_C4 76 118 4.35e-4 SMART
Pfam:Hormone_recep 175 270 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137734
Predicted Effect probably benign
Transcript: ENSMUST00000139541
SMART Domains Protein: ENSMUSP00000122406
Gene: ENSMUSG00000002395

DomainStartEndE-ValueType
Pfam:Use1 15 74 2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156270
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Ocel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4744:Ocel1 UTSW 8 71372753 missense probably damaging 1.00
R5560:Ocel1 UTSW 8 71372478 missense probably damaging 0.99
R6256:Ocel1 UTSW 8 71371828 unclassified probably benign
R7653:Ocel1 UTSW 8 71371916 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATACATGCAGGTCCCGCCTC -3'
(R):5'- GCAATTGGCTTTCCTTTGCCAGTG -3'

Sequencing Primer
(F):5'- GGAAGCCACTTGCAATTCG -3'
(R):5'- GTGCTGACCACCAAATCAAAATG -3'
Posted On2013-11-18