Incidental Mutation 'R1084:Dna2'
ID84961
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62949187 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 28 (R28W)
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044977] [ENSMUST00000092462] [ENSMUST00000131422] [ENSMUST00000144459]
Predicted Effect probably benign
Transcript: ENSMUST00000044977
SMART Domains Protein: ENSMUSP00000043370
Gene: ENSMUSG00000071253

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:Mito_carr 32 125 1.7e-25 PFAM
Pfam:Mito_carr 127 220 2.3e-26 PFAM
Pfam:Mito_carr 237 332 8.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092462
AA Change: R28W

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875
AA Change: R28W

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129785
Predicted Effect probably benign
Transcript: ENSMUST00000131422
AA Change: R28W

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875
AA Change: R28W

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131715
Predicted Effect probably benign
Transcript: ENSMUST00000144459
SMART Domains Protein: ENSMUSP00000114510
Gene: ENSMUSG00000071253

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:Mito_carr 32 125 9.4e-28 PFAM
Pfam:Mito_carr 126 223 4.6e-25 PFAM
Pfam:Mito_carr 240 322 2.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152350
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1562:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5567:Dna2 UTSW 10 62966673 missense possibly damaging 0.89
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6820:Dna2 UTSW 10 62964904 missense possibly damaging 0.93
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7508:Dna2 UTSW 10 62971993 splice site probably null
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R7983:Dna2 UTSW 10 62955394 missense probably benign 0.04
R8498:Dna2 UTSW 10 62973315 missense probably benign 0.12
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGGTTCATCGTGTCCAGCTTC -3'
(R):5'- TGCACAGAACTTCGTGCTCTCG -3'

Sequencing Primer
(F):5'- ccaccacactcagacacc -3'
(R):5'- TCGTGCTCTCGGTCCTG -3'
Posted On2013-11-18