Incidental Mutation 'R1084:Arhgap9'
ID84962
Institutional Source Beutler Lab
Gene Symbol Arhgap9
Ensembl Gene ENSMUSG00000040345
Gene NameRho GTPase activating protein 9
Synonyms
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127321964-127329943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127327928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 478 (S478G)
Ref Sequence ENSEMBL: ENSMUSP00000151690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
Predicted Effect probably benign
Transcript: ENSMUST00000026474
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069548
AA Change: S303G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345
AA Change: S303G

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218656
Predicted Effect probably damaging
Transcript: ENSMUST00000219026
AA Change: S303G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000219511
AA Change: S478G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Meta Mutation Damage Score 0.2892 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-GAP family of GTPase activating proteins. The protein has substantial GAP activity towards several Rho-family GTPases in vitro, converting them to an inactive GDP-bound state. It is implicated in regulating adhesion of hematopoietic cells to the extracellular matrix. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Arhgap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Arhgap9 APN 10 127327893 splice site probably benign
IGL01069:Arhgap9 APN 10 127328952 missense probably damaging 1.00
IGL02444:Arhgap9 APN 10 127327947 missense probably damaging 1.00
IGL02707:Arhgap9 APN 10 127329607 missense probably damaging 0.98
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0242:Arhgap9 UTSW 10 127329538 missense probably benign 0.13
R0841:Arhgap9 UTSW 10 127329639 missense probably damaging 0.98
R1707:Arhgap9 UTSW 10 127328889 missense probably benign 0.00
R1799:Arhgap9 UTSW 10 127327724 missense probably damaging 1.00
R2423:Arhgap9 UTSW 10 127327124 unclassified probably null
R2511:Arhgap9 UTSW 10 127328985 critical splice donor site probably null
R3721:Arhgap9 UTSW 10 127328971 missense possibly damaging 0.84
R3803:Arhgap9 UTSW 10 127329517 missense possibly damaging 0.64
R4261:Arhgap9 UTSW 10 127328465 missense probably damaging 1.00
R4968:Arhgap9 UTSW 10 127327006 missense possibly damaging 0.80
R5423:Arhgap9 UTSW 10 127329549 missense probably damaging 1.00
R5425:Arhgap9 UTSW 10 127326418 missense probably damaging 1.00
R6697:Arhgap9 UTSW 10 127322120 missense probably benign 0.34
R6969:Arhgap9 UTSW 10 127326643 missense probably benign 0.39
X0067:Arhgap9 UTSW 10 127328432 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAGATTCCAGTCTGAGTCCGC -3'
(R):5'- CGTTCTGCAACATACAGGAGAGACC -3'

Sequencing Primer
(F):5'- AGGTTATTTTTCCGAAGACACCC -3'
(R):5'- CATACAGGAGAGACCAGTAGCTTAG -3'
Posted On2013-11-18