Mutagenetix > Incidental Mutations

Incidental Mutation 'R1084:Myo1d'

84966

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

039170-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80684395 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 165 (Y165C)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: Y165C

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000070997
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: Y165C

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125944

Meta Mutation Damage Score

0.9700

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,918,155		probably benign	Het
Abcg4	C	T	9: 44,277,469	V476M	probably benign	Het
Arhgap9	A	G	10: 127,327,928	S478G	probably damaging	Het
Blvra	A	G	2: 127,080,653	T3A	probably benign	Het
Crygb	C	T	1: 65,080,495	D109N	possibly damaging	Het
Cyp3a59	A	T	5: 146,096,674	T207S	probably benign	Het
Cyp4b1	A	G	4: 115,640,312	V163A	probably benign	Het
Dmxl2	A	T	9: 54,416,433	S1222R	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	G	A	15: 28,343,452	V2333I	probably benign	Het
Eral1	C	T	11: 78,074,498	V364M	probably damaging	Het
Fat4	T	C	3: 38,979,825	V2542A	possibly damaging	Het
Glcci1	C	T	6: 8,573,221	Q50*	probably null	Het
Heg1	A	G	16: 33,706,997	D109G	probably benign	Het
Lama1	C	A	17: 67,804,469	S2238R	probably benign	Het
Ltbp1	G	A	17: 75,359,425	W1053*	probably null	Het
Ly6f	T	C	15: 75,268,773	L15P	probably damaging	Het
Mapk8	T	A	14: 33,388,803	K290*	probably null	Het
Mbd1	A	G	18: 74,269,532	Y35C	probably damaging	Het
Mcf2l	T	C	8: 13,002,645	V503A	possibly damaging	Het
Morc2a	A	G	11: 3,650,454		probably benign	Het
Ms4a8a	T	A	19: 11,076,362	I127F	probably damaging	Het
Ocel1	G	T	8: 71,371,988		probably null	Het
Plekhh2	C	T	17: 84,571,126	T603M	probably damaging	Het
Rab6b	C	T	9: 103,162,635	T128M	probably damaging	Het
Scel	G	T	14: 103,564,843		probably null	Het
Sec23a	A	T	12: 58,985,135	N436K	probably damaging	Het
Sec24a	A	G	11: 51,713,581	L736P	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Tex15	A	G	8: 33,577,004	E2154G	probably benign	Het
Tnrc18	A	G	5: 142,764,767		probably null	Het
Tpr	A	G	1: 150,442,161	Q2140R	probably benign	Het
Zfp142	T	C	1: 74,571,826	R834G	probably benign	Het
Zfp276	G	A	8: 123,254,723	R3Q	probably damaging	Het
Zscan4d	A	T	7: 11,165,005	L115Q	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R7942:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACAATGCCTGACTCGATGCAC -3'
(R):5'- AGCAAGCAGTTCCTACACATATGCC -3'

Sequencing Primer
(F):5'- GACTCGATGCACTAAGTGTTC -3'
(R):5'- GGGACGATGGTCCACTAATC -3'

Posted On

2013-11-18