Incidental Mutation 'R1084:Myo1d'
ID84966
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80684395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 165 (Y165C)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: Y165C

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: Y165C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: Y165C

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125944
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R7942:Myo1d UTSW 11 80684377 missense probably damaging 1.00
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAATGCCTGACTCGATGCAC -3'
(R):5'- AGCAAGCAGTTCCTACACATATGCC -3'

Sequencing Primer
(F):5'- GACTCGATGCACTAAGTGTTC -3'
(R):5'- GGGACGATGGTCCACTAATC -3'
Posted On2013-11-18