Mutagenetix > Incidental Mutations

Incidental Mutation 'R1084:Sec23a'

84967

Institutional Source

Beutler Lab

Gene Symbol

Sec23a

Ensembl Gene

ENSMUSG00000020986

Gene Name

SEC23 homolog A, COPII coat complex component

Synonyms

Sec23r, Msec23

MMRRC Submission

039170-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R1084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58958383-59012017 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58985135 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 436 (N436K)

Ref Sequence

ENSEMBL: ENSMUSP00000126011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]

Predicted Effect

probably benign
Transcript: ENSMUST00000021375
AA Change: N465K

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: N465K

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	58	98	2.7e-17	PFAM
Pfam:Sec23_trunk	126	390	2e-81	PFAM
Pfam:Sec23_BS	401	504	3.2e-35	PFAM
Pfam:Sec23_helical	520	618	1e-30	PFAM
Pfam:Gelsolin	629	718	9.3e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165134
AA Change: N436K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: N436K

Domain	Start	End	E-Value	Type
Pfam:zf-Sec23_Sec24	57	98	8.1e-16	PFAM
Pfam:Sec23_trunk	97	361	6.5e-84	PFAM
Pfam:Sec23_BS	372	475	3.8e-36	PFAM
Pfam:Sec23_helical	490	590	1.6e-38	PFAM
Pfam:Gelsolin	599	689	2.7e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169976

Meta Mutation Damage Score

0.1792

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,918,155		probably benign	Het
Abcg4	C	T	9: 44,277,469	V476M	probably benign	Het
Arhgap9	A	G	10: 127,327,928	S478G	probably damaging	Het
Blvra	A	G	2: 127,080,653	T3A	probably benign	Het
Crygb	C	T	1: 65,080,495	D109N	possibly damaging	Het
Cyp3a59	A	T	5: 146,096,674	T207S	probably benign	Het
Cyp4b1	A	G	4: 115,640,312	V163A	probably benign	Het
Dmxl2	A	T	9: 54,416,433	S1222R	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	G	A	15: 28,343,452	V2333I	probably benign	Het
Eral1	C	T	11: 78,074,498	V364M	probably damaging	Het
Fat4	T	C	3: 38,979,825	V2542A	possibly damaging	Het
Glcci1	C	T	6: 8,573,221	Q50*	probably null	Het
Heg1	A	G	16: 33,706,997	D109G	probably benign	Het
Lama1	C	A	17: 67,804,469	S2238R	probably benign	Het
Ltbp1	G	A	17: 75,359,425	W1053*	probably null	Het
Ly6f	T	C	15: 75,268,773	L15P	probably damaging	Het
Mapk8	T	A	14: 33,388,803	K290*	probably null	Het
Mbd1	A	G	18: 74,269,532	Y35C	probably damaging	Het
Mcf2l	T	C	8: 13,002,645	V503A	possibly damaging	Het
Morc2a	A	G	11: 3,650,454		probably benign	Het
Ms4a8a	T	A	19: 11,076,362	I127F	probably damaging	Het
Myo1d	T	C	11: 80,684,395	Y165C	probably damaging	Het
Ocel1	G	T	8: 71,371,988		probably null	Het
Plekhh2	C	T	17: 84,571,126	T603M	probably damaging	Het
Rab6b	C	T	9: 103,162,635	T128M	probably damaging	Het
Scel	G	T	14: 103,564,843		probably null	Het
Sec24a	A	G	11: 51,713,581	L736P	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Tex15	A	G	8: 33,577,004	E2154G	probably benign	Het
Tnrc18	A	G	5: 142,764,767		probably null	Het
Tpr	A	G	1: 150,442,161	Q2140R	probably benign	Het
Zfp142	T	C	1: 74,571,826	R834G	probably benign	Het
Zfp276	G	A	8: 123,254,723	R3Q	probably damaging	Het
Zscan4d	A	T	7: 11,165,005	L115Q	probably damaging	Het

Other mutations in Sec23a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Sec23a	APN	12	58992282	missense	possibly damaging	0.47
IGL01836:Sec23a	APN	12	58971287	missense	probably damaging	0.98
IGL01906:Sec23a	APN	12	59007044	missense	probably damaging	1.00
IGL02383:Sec23a	APN	12	59002027	missense	probably damaging	1.00
IGL02507:Sec23a	APN	12	59007098	missense	probably benign	0.34
IGL02816:Sec23a	APN	12	58978545	missense	probably benign	0.03
IGL03060:Sec23a	APN	12	58986105	missense	probably benign
R0308:Sec23a	UTSW	12	59007199	nonsense	probably null
R0361:Sec23a	UTSW	12	58991018	missense	probably damaging	1.00
R0546:Sec23a	UTSW	12	58985167	missense	probably benign	0.07
R0720:Sec23a	UTSW	12	58971271	missense	probably damaging	1.00
R1156:Sec23a	UTSW	12	59001836	missense	probably benign
R1438:Sec23a	UTSW	12	59002010	missense	probably damaging	0.98
R1446:Sec23a	UTSW	12	58978559	missense	probably damaging	1.00
R1526:Sec23a	UTSW	12	58986186	splice site	probably null
R1705:Sec23a	UTSW	12	59001866	missense	possibly damaging	0.95
R1997:Sec23a	UTSW	12	59002007	missense	probably benign
R2051:Sec23a	UTSW	12	58990968	splice site	probably null
R2081:Sec23a	UTSW	12	58998281	nonsense	probably null
R4201:Sec23a	UTSW	12	59002005	missense	probably benign	0.00
R4706:Sec23a	UTSW	12	58982586	missense	probably damaging	0.98
R4724:Sec23a	UTSW	12	58978506	missense	probably damaging	0.99
R4969:Sec23a	UTSW	12	59004488	critical splice donor site	probably null
R5375:Sec23a	UTSW	12	59007005	missense	probably benign	0.15
R5858:Sec23a	UTSW	12	58973035	missense	probably damaging	0.98
R6539:Sec23a	UTSW	12	58985212	missense	probably benign	0.00
R6558:Sec23a	UTSW	12	59004552	missense	probably benign	0.03
R6616:Sec23a	UTSW	12	58997155	missense	possibly damaging	0.95
R6716:Sec23a	UTSW	12	58968823	missense	probably benign	0.09
R7078:Sec23a	UTSW	12	58992283	missense	probably benign	0.07
R7155:Sec23a	UTSW	12	58989443	missense	probably benign	0.03
R7367:Sec23a	UTSW	12	58966999	missense	probably benign
R7923:Sec23a	UTSW	12	58992247	missense	probably damaging	0.99
R8178:Sec23a	UTSW	12	59007194	missense	possibly damaging	0.93
R8557:Sec23a	UTSW	12	59005270	missense	probably damaging	0.96
Z1088:Sec23a	UTSW	12	59004576	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAAAACAAAACAGGCATTGCGGC -3'
(R):5'- CCAGAGGCGTATCCCTGCTCTT -3'

Sequencing Primer
(F):5'- tctaccgattcactgctaacc -3'
(R):5'- AGATTGGAACAGGAGGCACT -3'

Posted On

2013-11-18