Incidental Mutation 'R1084:Sec23a'
ID84967
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58985135 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 436 (N436K)
Ref Sequence ENSEMBL: ENSMUSP00000126011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably benign
Transcript: ENSMUST00000021375
AA Change: N465K

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: N465K

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165134
AA Change: N436K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: N436K

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169976
Meta Mutation Damage Score 0.1792 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAACAAAACAGGCATTGCGGC -3'
(R):5'- CCAGAGGCGTATCCCTGCTCTT -3'

Sequencing Primer
(F):5'- tctaccgattcactgctaacc -3'
(R):5'- AGATTGGAACAGGAGGCACT -3'
Posted On2013-11-18