Incidental Mutation 'R1084:Heg1'
ID84974
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
MMRRC Submission 039170-MU
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33706997 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000119790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect probably benign
Transcript: ENSMUST00000126532
AA Change: D109G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: D109G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152782
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154863
Predicted Effect probably benign
Transcript: ENSMUST00000232568
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
dictator UTSW 16 33706997 missense probably benign 0.26
hegemon UTSW 16 33760803 missense probably damaging 1.00
wittgenstein UTSW 16 33720730 nonsense probably null
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
R7614:Heg1 UTSW 16 33727363 missense probably benign
R7638:Heg1 UTSW 16 33727497 missense probably damaging 1.00
R7880:Heg1 UTSW 16 33719509 missense possibly damaging 0.93
R7942:Heg1 UTSW 16 33751200 missense probably damaging 1.00
R7977:Heg1 UTSW 16 33720730 nonsense probably null
R7984:Heg1 UTSW 16 33763575 missense possibly damaging 0.83
R7987:Heg1 UTSW 16 33720730 nonsense probably null
R8023:Heg1 UTSW 16 33730525 missense possibly damaging 0.61
R8312:Heg1 UTSW 16 33726675 missense probably benign 0.02
R8745:Heg1 UTSW 16 33735616 missense probably benign 0.00
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Z1177:Heg1 UTSW 16 33720687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCACGCGGTCAGCAATAAACTC -3'
(R):5'- TCACACAACAAGCTGCTGTGGG -3'

Sequencing Primer
(F):5'- CAATAAACTCCGAGGGTCATTTTG -3'
(R):5'- CCGTGGTGATCTCAGGGG -3'
Posted On2013-11-18