Incidental Mutation 'R1085:Tex2'
ID84987
Institutional Source Beutler Lab
Gene Symbol Tex2
Ensembl Gene ENSMUSG00000040548
Gene Nametestis expressed gene 2
SynonymsDef-5, Taz4, 4930568E07Rik
MMRRC Submission 039171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1085 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106502147-106613423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106568487 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 39 (S39L)
Ref Sequence ENSEMBL: ENSMUSP00000041985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042780] [ENSMUST00000103070] [ENSMUST00000128933] [ENSMUST00000153870]
Predicted Effect probably damaging
Transcript: ENSMUST00000042780
AA Change: S39L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548
AA Change: S39L

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
low complexity region 811 823 N/A INTRINSIC
low complexity region 946 965 N/A INTRINSIC
low complexity region 1003 1016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103070
AA Change: S39L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099359
Gene: ENSMUSG00000040548
AA Change: S39L

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128933
AA Change: S39L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120781
Gene: ENSMUSG00000040548
AA Change: S39L

DomainStartEndE-ValueType
low complexity region 119 168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153870
AA Change: S39L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000207249
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,388,252 T278S probably benign Het
Ahnak T A 19: 9,013,125 D3924E possibly damaging Het
Cfap57 T A 4: 118,595,779 T576S probably benign Het
Cntnap1 G A 11: 101,178,836 R247K probably benign Het
Fam69c A G 18: 84,739,384 I198V possibly damaging Het
Gldc C A 19: 30,151,428 C215F probably damaging Het
Grm4 T A 17: 27,473,033 Y204F probably damaging Het
Itga11 T G 9: 62,677,970 V9G probably benign Het
Mc2r A G 18: 68,407,346 F292S probably benign Het
Mcur1 A G 13: 43,555,004 S124P unknown Het
Mkl1 T C 15: 81,020,883 D116G probably damaging Het
Nin G T 12: 70,020,962 Q1964K possibly damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1472 C T 19: 13,454,230 A96T possibly damaging Het
Olfr291 A G 7: 84,856,779 T137A probably benign Het
Psd2 G A 18: 36,012,777 A745T probably benign Het
Rrp36 A G 17: 46,667,952 *227Q probably null Het
Sh3tc2 A C 18: 62,014,996 D1259A probably benign Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tor1a A G 2: 30,967,784 I24T possibly damaging Het
Troap T C 15: 99,082,163 V408A probably damaging Het
Ttc16 A T 2: 32,775,080 S12T possibly damaging Het
Wdr37 A T 13: 8,805,928 C460S probably damaging Het
Other mutations in Tex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tex2 APN 11 106568535 missense probably damaging 1.00
IGL01380:Tex2 APN 11 106544315 nonsense probably null
IGL02607:Tex2 APN 11 106546747 missense unknown
IGL02680:Tex2 APN 11 106568232 unclassified probably benign
IGL02699:Tex2 APN 11 106568433 missense possibly damaging 0.53
IGL03187:Tex2 APN 11 106568077 unclassified probably benign
IGL03398:Tex2 APN 11 106568272 missense probably damaging 1.00
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R1491:Tex2 UTSW 11 106503640 missense possibly damaging 0.72
R1664:Tex2 UTSW 11 106567782 unclassified probably benign
R1794:Tex2 UTSW 11 106567902 unclassified probably benign
R1855:Tex2 UTSW 11 106546876 missense possibly damaging 0.87
R2077:Tex2 UTSW 11 106506864 splice site probably null
R2151:Tex2 UTSW 11 106567335 unclassified probably benign
R2175:Tex2 UTSW 11 106503687 missense unknown
R2984:Tex2 UTSW 11 106546663 critical splice donor site probably null
R3156:Tex2 UTSW 11 106533869 critical splice donor site probably null
R3722:Tex2 UTSW 11 106546740 nonsense probably null
R3724:Tex2 UTSW 11 106529330 missense unknown
R3770:Tex2 UTSW 11 106544252 missense unknown
R3771:Tex2 UTSW 11 106546894 missense unknown
R3813:Tex2 UTSW 11 106511944 missense unknown
R3947:Tex2 UTSW 11 106520003 missense unknown
R4206:Tex2 UTSW 11 106567572 unclassified probably benign
R4342:Tex2 UTSW 11 106567006 unclassified probably benign
R4554:Tex2 UTSW 11 106544386 missense unknown
R4896:Tex2 UTSW 11 106568404 missense probably damaging 1.00
R5207:Tex2 UTSW 11 106546840 missense unknown
R5249:Tex2 UTSW 11 106546789 missense unknown
R5257:Tex2 UTSW 11 106567759 unclassified probably benign
R5258:Tex2 UTSW 11 106567759 unclassified probably benign
R5278:Tex2 UTSW 11 106567813 missense probably benign 0.34
R5702:Tex2 UTSW 11 106544395 missense possibly damaging 0.58
R5835:Tex2 UTSW 11 106519913 missense unknown
R6150:Tex2 UTSW 11 106567080 missense probably benign 0.34
R6785:Tex2 UTSW 11 106533950 missense probably damaging 1.00
R6879:Tex2 UTSW 11 106534010 missense unknown
R7038:Tex2 UTSW 11 106511900 critical splice donor site probably null
R7117:Tex2 UTSW 11 106544245 missense unknown
R7336:Tex2 UTSW 11 106548859 missense unknown
R7568:Tex2 UTSW 11 106548736 missense unknown
R7622:Tex2 UTSW 11 106546895 missense unknown
T0970:Tex2 UTSW 11 106546946 missense unknown
Z1177:Tex2 UTSW 11 106534008 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCCAGCAGCTTTACAGTGTTCTC -3'
(R):5'- TGTCTCAGGAGCCTTAAGCTCAGC -3'

Sequencing Primer
(F):5'- TTACAGTGTTCTCAGAGACAGGC -3'
(R):5'- GTTTGCTCCTAAGAGAGAATGCC -3'
Posted On2013-11-18