Incidental Mutation 'R1085:Mcur1'
ID84990
Institutional Source Beutler Lab
Gene Symbol Mcur1
Ensembl Gene ENSMUSG00000021371
Gene Namemitochondrial calcium uniporter regulator 1
Synonyms6230416A05Rik, Ccdc90a
MMRRC Submission 039171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1085 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location43538393-43560191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43555004 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000021800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021800]
Predicted Effect unknown
Transcript: ENSMUST00000021800
AA Change: S124P
SMART Domains Protein: ENSMUSP00000021800
Gene: ENSMUSG00000021371
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 48 80 N/A INTRINSIC
low complexity region 85 125 N/A INTRINSIC
Pfam:DUF1640 147 339 3.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223353
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, reduced body size and impaired mitochondrial calcium uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,388,252 T278S probably benign Het
Ahnak T A 19: 9,013,125 D3924E possibly damaging Het
Cfap57 T A 4: 118,595,779 T576S probably benign Het
Cntnap1 G A 11: 101,178,836 R247K probably benign Het
Fam69c A G 18: 84,739,384 I198V possibly damaging Het
Gldc C A 19: 30,151,428 C215F probably damaging Het
Grm4 T A 17: 27,473,033 Y204F probably damaging Het
Itga11 T G 9: 62,677,970 V9G probably benign Het
Mc2r A G 18: 68,407,346 F292S probably benign Het
Mkl1 T C 15: 81,020,883 D116G probably damaging Het
Nin G T 12: 70,020,962 Q1964K possibly damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1472 C T 19: 13,454,230 A96T possibly damaging Het
Olfr291 A G 7: 84,856,779 T137A probably benign Het
Psd2 G A 18: 36,012,777 A745T probably benign Het
Rrp36 A G 17: 46,667,952 *227Q probably null Het
Sh3tc2 A C 18: 62,014,996 D1259A probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex2 G A 11: 106,568,487 S39L probably damaging Het
Tor1a A G 2: 30,967,784 I24T possibly damaging Het
Troap T C 15: 99,082,163 V408A probably damaging Het
Ttc16 A T 2: 32,775,080 S12T possibly damaging Het
Wdr37 A T 13: 8,805,928 C460S probably damaging Het
Other mutations in Mcur1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Mcur1 APN 13 43541727 missense probably damaging 1.00
R0197:Mcur1 UTSW 13 43545740 missense probably damaging 1.00
R0701:Mcur1 UTSW 13 43545740 missense probably damaging 1.00
R1793:Mcur1 UTSW 13 43560015 missense unknown
R2418:Mcur1 UTSW 13 43549537 missense possibly damaging 0.91
R2419:Mcur1 UTSW 13 43549537 missense possibly damaging 0.91
R2508:Mcur1 UTSW 13 43544465 missense probably damaging 1.00
R4535:Mcur1 UTSW 13 43544540 missense probably damaging 1.00
R4817:Mcur1 UTSW 13 43551671 missense possibly damaging 0.92
R6542:Mcur1 UTSW 13 43551658 missense probably damaging 1.00
R7137:Mcur1 UTSW 13 43544455 critical splice donor site probably null
R7177:Mcur1 UTSW 13 43544536 missense probably damaging 0.98
R7589:Mcur1 UTSW 13 43551625 missense probably damaging 1.00
R7679:Mcur1 UTSW 13 43544483 nonsense probably null
R7859:Mcur1 UTSW 13 43560009 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCACTGATCCAAGGTCGGGG -3'
(R):5'- AGGACTGTCATCACTGGGTTTGAGG -3'

Sequencing Primer
(F):5'- TCCAAGGTCGGGGGAGTG -3'
(R):5'- AGACCCTGTTTGACACATATGGC -3'
Posted On2013-11-18