Incidental Mutation 'R1085:Tedc2'
ID84997
Institutional Source Beutler Lab
Gene Symbol Tedc2
Ensembl Gene ENSMUSG00000024118
Gene Nametubulin epsilon and delta complex 2
Synonyms1600002H07Rik
MMRRC Submission 039171-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R1085 (G1)
Quality Score179
Status Not validated
Chromosome17
Chromosomal Location24215054-24220851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24216317 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 366 (E366V)
Ref Sequence ENSEMBL: ENSMUSP00000024930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024930]
Predicted Effect probably damaging
Transcript: ENSMUST00000024930
AA Change: E366V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118
AA Change: E366V

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
low complexity region 78 84 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
Pfam:DUF4693 150 434 8.6e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124557
SMART Domains Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171563
Meta Mutation Damage Score 0.4034 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,388,252 T278S probably benign Het
Ahnak T A 19: 9,013,125 D3924E possibly damaging Het
Cfap57 T A 4: 118,595,779 T576S probably benign Het
Cntnap1 G A 11: 101,178,836 R247K probably benign Het
Fam69c A G 18: 84,739,384 I198V possibly damaging Het
Gldc C A 19: 30,151,428 C215F probably damaging Het
Grm4 T A 17: 27,473,033 Y204F probably damaging Het
Itga11 T G 9: 62,677,970 V9G probably benign Het
Mc2r A G 18: 68,407,346 F292S probably benign Het
Mcur1 A G 13: 43,555,004 S124P unknown Het
Mkl1 T C 15: 81,020,883 D116G probably damaging Het
Nin G T 12: 70,020,962 Q1964K possibly damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1472 C T 19: 13,454,230 A96T possibly damaging Het
Olfr291 A G 7: 84,856,779 T137A probably benign Het
Psd2 G A 18: 36,012,777 A745T probably benign Het
Rrp36 A G 17: 46,667,952 *227Q probably null Het
Sh3tc2 A C 18: 62,014,996 D1259A probably benign Het
Tex2 G A 11: 106,568,487 S39L probably damaging Het
Tor1a A G 2: 30,967,784 I24T possibly damaging Het
Troap T C 15: 99,082,163 V408A probably damaging Het
Ttc16 A T 2: 32,775,080 S12T possibly damaging Het
Wdr37 A T 13: 8,805,928 C460S probably damaging Het
Other mutations in Tedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Tedc2 APN 17 24217952 missense probably benign 0.01
IGL02111:Tedc2 APN 17 24218166 splice site probably benign
IGL02347:Tedc2 APN 17 24220610 missense probably damaging 1.00
IGL03400:Tedc2 APN 17 24219803 missense probably benign
R0766:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R0766:Tedc2 UTSW 17 24216318 nonsense probably null
R1066:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1066:Tedc2 UTSW 17 24216318 nonsense probably null
R1067:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1067:Tedc2 UTSW 17 24216318 nonsense probably null
R1085:Tedc2 UTSW 17 24216318 nonsense probably null
R1086:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1086:Tedc2 UTSW 17 24216318 nonsense probably null
R1136:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1136:Tedc2 UTSW 17 24216318 nonsense probably null
R1137:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1137:Tedc2 UTSW 17 24216318 nonsense probably null
R1203:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1203:Tedc2 UTSW 17 24216318 nonsense probably null
R1345:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1345:Tedc2 UTSW 17 24216318 nonsense probably null
R1385:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1385:Tedc2 UTSW 17 24216318 nonsense probably null
R1396:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1396:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1891:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1891:Tedc2 UTSW 17 24216318 nonsense probably null
R1943:Tedc2 UTSW 17 24217949 missense possibly damaging 0.90
R1984:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1984:Tedc2 UTSW 17 24216318 nonsense probably null
R1985:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1985:Tedc2 UTSW 17 24216318 nonsense probably null
R1986:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1986:Tedc2 UTSW 17 24216318 nonsense probably null
R2026:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2026:Tedc2 UTSW 17 24216318 nonsense probably null
R2054:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2054:Tedc2 UTSW 17 24216318 nonsense probably null
R2086:Tedc2 UTSW 17 24217900 missense probably damaging 1.00
R2317:Tedc2 UTSW 17 24216384 missense probably benign 0.00
R3705:Tedc2 UTSW 17 24216387 missense probably benign 0.30
R4085:Tedc2 UTSW 17 24219839 missense probably benign 0.01
R4664:Tedc2 UTSW 17 24220140 splice site probably benign
R4676:Tedc2 UTSW 17 24220011 missense probably benign
R4686:Tedc2 UTSW 17 24217888 critical splice donor site probably null
R4762:Tedc2 UTSW 17 24216380 missense probably benign 0.05
R4837:Tedc2 UTSW 17 24220593 missense probably damaging 1.00
R4863:Tedc2 UTSW 17 24217936 missense probably damaging 1.00
R5936:Tedc2 UTSW 17 24216341 missense probably damaging 1.00
RF031:Tedc2 UTSW 17 24216239 critical splice donor site probably benign
Z1177:Tedc2 UTSW 17 24220571 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTACTGCTTCTCCCGAGACTTAC -3'
(R):5'- TGCATACTACGGGCTGCTACACAC -3'

Sequencing Primer
(F):5'- TCCCGAGACTTACCCTGG -3'
(R):5'- ctgcctgcctctgcctc -3'
Posted On2013-11-18