Incidental Mutation 'R1085:Gldc'
ID 85007
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 039171-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1085 (G1)
Quality Score 199
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 30128828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 215 (C215F)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: C215F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: C215F

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agxt2 A T 15: 10,388,338 (GRCm39) T278S probably benign Het
Ahnak T A 19: 8,990,489 (GRCm39) D3924E possibly damaging Het
Cfap57 T A 4: 118,452,976 (GRCm39) T576S probably benign Het
Cntnap1 G A 11: 101,069,662 (GRCm39) R247K probably benign Het
Dipk1c A G 18: 84,757,509 (GRCm39) I198V possibly damaging Het
Grm4 T A 17: 27,692,007 (GRCm39) Y204F probably damaging Het
Itga11 T G 9: 62,585,252 (GRCm39) V9G probably benign Het
Mc2r A G 18: 68,540,417 (GRCm39) F292S probably benign Het
Mcur1 A G 13: 43,708,480 (GRCm39) S124P unknown Het
Mrtfa T C 15: 80,905,084 (GRCm39) D116G probably damaging Het
Nin G T 12: 70,067,736 (GRCm39) Q1964K possibly damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Or5ae2 A G 7: 84,505,987 (GRCm39) T137A probably benign Het
Or5b117 C T 19: 13,431,594 (GRCm39) A96T possibly damaging Het
Psd2 G A 18: 36,145,830 (GRCm39) A745T probably benign Het
Rrp36 A G 17: 46,978,878 (GRCm39) *227Q probably null Het
Sh3tc2 A C 18: 62,148,067 (GRCm39) D1259A probably benign Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tex2 G A 11: 106,459,313 (GRCm39) S39L probably damaging Het
Tor1a A G 2: 30,857,796 (GRCm39) I24T possibly damaging Het
Troap T C 15: 98,980,044 (GRCm39) V408A probably damaging Het
Ttc16 A T 2: 32,665,092 (GRCm39) S12T possibly damaging Het
Wdr37 A T 13: 8,855,964 (GRCm39) C460S probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTaattcgacacggtggctc -3'
(R):5'- AGTACACTCCGTATCAGCCAGAGG -3'

Sequencing Primer
(F):5'- tggaaggtagaggtggagg -3'
(R):5'- TATCAGCCAGAGGTGTCCCAG -3'
Posted On 2013-11-18