Incidental Mutation 'R1086:Uba6'
ID85019
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Nameubiquitin-like modifier activating enzyme 6
SynonymsUbe1l2, 5730469D23Rik
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1086 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location86109287-86172803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86127719 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 739 (C739F)
Ref Sequence ENSEMBL: ENSMUSP00000109000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
Predicted Effect probably benign
Transcript: ENSMUST00000039373
AA Change: C770F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: C770F

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113373
AA Change: C739F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: C739F

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147734
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
Ano6 T C 15: 95,949,962 probably null Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Got1l1 A G 8: 27,197,979 W341R probably damaging Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Olfr187 T A 16: 59,036,263 H158L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ppp2r3a G A 9: 101,153,822 T245I possibly damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rnh1 T G 7: 141,163,369 Q231P probably benign Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86119407 missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86150048 missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86120529 nonsense probably null
IGL01807:Uba6 APN 5 86122411 missense probably damaging 1.00
IGL01919:Uba6 APN 5 86119386 missense probably benign 0.01
IGL02131:Uba6 APN 5 86150077 missense probably benign 0.18
IGL03107:Uba6 APN 5 86127774 splice site probably benign
R0314:Uba6 UTSW 5 86118087 missense probably damaging 0.99
R0350:Uba6 UTSW 5 86144378 missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86112750 missense probably damaging 1.00
R0964:Uba6 UTSW 5 86119401 missense possibly damaging 0.47
R1440:Uba6 UTSW 5 86140423 missense probably damaging 1.00
R1564:Uba6 UTSW 5 86154407 missense probably benign
R2377:Uba6 UTSW 5 86124370 missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2421:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2422:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2924:Uba6 UTSW 5 86159271 missense probably damaging 1.00
R3723:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R3724:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R4429:Uba6 UTSW 5 86120547 missense probably damaging 0.99
R4590:Uba6 UTSW 5 86112744 missense probably damaging 1.00
R4831:Uba6 UTSW 5 86131338 missense probably benign
R4908:Uba6 UTSW 5 86140434 splice site silent
R5193:Uba6 UTSW 5 86124422 missense probably benign 0.12
R5505:Uba6 UTSW 5 86120546 missense probably benign 0.09
R5560:Uba6 UTSW 5 86131260 missense probably damaging 1.00
R5586:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R5589:Uba6 UTSW 5 86122429 missense probably damaging 0.99
R5787:Uba6 UTSW 5 86112652 makesense probably null
R6255:Uba6 UTSW 5 86164765 missense probably benign 0.25
R6512:Uba6 UTSW 5 86124403 missense probably benign
R6772:Uba6 UTSW 5 86147073 critical splice donor site probably null
R7536:Uba6 UTSW 5 86124332 missense probably benign 0.05
R7571:Uba6 UTSW 5 86147111 missense probably benign 0.02
R7609:Uba6 UTSW 5 86147075 missense probably benign 0.17
R7768:Uba6 UTSW 5 86152920 missense probably benign 0.01
R7866:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7894:Uba6 UTSW 5 86118065 nonsense probably null
R7922:Uba6 UTSW 5 86122412 synonymous probably null
R7949:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7977:Uba6 UTSW 5 86118065 nonsense probably null
R8063:Uba6 UTSW 5 86152685 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCTCATGGCTCAAACAAATGCACG -3'
(R):5'- GCACACTCTCATCGAACACTTGGC -3'

Sequencing Primer
(F):5'- ggCTCAAACAAATGCACGAAAAG -3'
(R):5'- CCTGATGACTGCTTGAATATAGTG -3'
Posted On2013-11-18