Incidental Mutation 'R1086:Got1l1'
ID85031
Institutional Source Beutler Lab
Gene Symbol Got1l1
Ensembl Gene ENSMUSG00000039720
Gene Nameglutamic-oxaloacetic transaminase 1-like 1
Synonyms
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1086 (G1)
Quality Score209
Status Validated
Chromosome8
Chromosomal Location27197459-27223828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27197979 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 341 (W341R)
Ref Sequence ENSEMBL: ENSMUSP00000041337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038174] [ENSMUST00000209299]
Predicted Effect probably damaging
Transcript: ENSMUST00000038174
AA Change: W341R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041337
Gene: ENSMUSG00000039720
AA Change: W341R

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 32 395 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209281
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Meta Mutation Damage Score 0.8950 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
Ano6 T C 15: 95,949,962 probably null Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Olfr187 T A 16: 59,036,263 H158L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ppp2r3a G A 9: 101,153,822 T245I possibly damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rnh1 T G 7: 141,163,369 Q231P probably benign Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Uba6 C A 5: 86,127,719 C739F probably benign Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Got1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Got1l1 APN 8 27197991 missense probably damaging 1.00
IGL02094:Got1l1 APN 8 27199845 missense probably benign 0.10
IGL03155:Got1l1 APN 8 27199332 missense probably damaging 1.00
IGL03395:Got1l1 APN 8 27200857 missense probably benign 0.00
R0026:Got1l1 UTSW 8 27200248 missense probably benign 0.00
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R2349:Got1l1 UTSW 8 27197931 missense probably benign 0.09
R3413:Got1l1 UTSW 8 27199836 critical splice donor site probably null
R4513:Got1l1 UTSW 8 27198485 missense probably benign 0.27
R4514:Got1l1 UTSW 8 27198485 missense probably benign 0.27
R5686:Got1l1 UTSW 8 27198059 missense probably damaging 1.00
R5979:Got1l1 UTSW 8 27197923 splice site probably null
R6023:Got1l1 UTSW 8 27199904 nonsense probably null
R6229:Got1l1 UTSW 8 27198436 splice site probably null
R7635:Got1l1 UTSW 8 27197934 missense probably damaging 1.00
R8101:Got1l1 UTSW 8 27200302 missense possibly damaging 0.68
R8104:Got1l1 UTSW 8 27197591 missense probably damaging 1.00
R8298:Got1l1 UTSW 8 27198558 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCAGCCCCACTTCTACAAGGATG -3'
(R):5'- AACCAGGTTCCAGCCGTGTGTTTC -3'

Sequencing Primer
(F):5'- TGTCAAGAGGAAATCCCGC -3'
(R):5'- AGCCGTGTGTTTCCTGAC -3'
Posted On2013-11-18