Incidental Mutation 'R1086:Ppp2r3a'
ID85033
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1086 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101153822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 245 (T245I)
Ref Sequence ENSEMBL: ENSMUSP00000069688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066773
AA Change: T245I

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154
AA Change: T245I

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075941
AA Change: T865I

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: T865I

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195293
Meta Mutation Damage Score 0.1230 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
Ano6 T C 15: 95,949,962 probably null Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Got1l1 A G 8: 27,197,979 W341R probably damaging Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Olfr187 T A 16: 59,036,263 H158L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rnh1 T G 7: 141,163,369 Q231P probably benign Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Uba6 C A 5: 86,127,719 C739F probably benign Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
R7512:Ppp2r3a UTSW 9 101175333 missense possibly damaging 0.69
R7655:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
R7656:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Z1176:Ppp2r3a UTSW 9 101126389 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACAGCCTTTTCCCCACATGAGTAAC -3'
(R):5'- CCAGTTTGACAGCCATCCTCTGAC -3'

Sequencing Primer
(F):5'- TCCCCACATGAGTAACTGATAAGTG -3'
(R):5'- CACTACTGAATAAGGTGTCCCTGTG -3'
Posted On2013-11-18