Incidental Mutation 'R1086:Ano6'
ID85043
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R1086 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 95949962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably null
Transcript: ENSMUST00000071874
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably null
Transcript: ENSMUST00000227791
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Got1l1 A G 8: 27,197,979 W341R probably damaging Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Olfr187 T A 16: 59,036,263 H158L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ppp2r3a G A 9: 101,153,822 T245I possibly damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rnh1 T G 7: 141,163,369 Q231P probably benign Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Uba6 C A 5: 86,127,719 C739F probably benign Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGCTGAGTCGTCTGCTTGCT -3'
(R):5'- ACCATTTGTGCTTGTGTGCATCTGC -3'

Sequencing Primer
(F):5'- GCTGCCTAATGAATAGTGACTTCC -3'
(R):5'- tgtcttcctcaatcttcatcctc -3'
Posted On2013-11-18