Incidental Mutation 'R1086:Olfr187'
ID85045
Institutional Source Beutler Lab
Gene Symbol Olfr187
Ensembl Gene ENSMUSG00000043357
Gene Nameolfactory receptor 187
SynonymsGA_x54KRFPKG5P-55265713-55264787, MOR183-8
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1086 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59035563-59039767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59036263 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 158 (H158L)
Ref Sequence ENSEMBL: ENSMUSP00000147035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000206428] [ENSMUST00000207673]
Predicted Effect probably damaging
Transcript: ENSMUST00000054385
AA Change: H158L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052477
Gene: ENSMUSG00000043357
AA Change: H158L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2e-50 PFAM
Pfam:7tm_1 40 289 8.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206408
Predicted Effect probably damaging
Transcript: ENSMUST00000206428
AA Change: H158L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207673
AA Change: H158L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2852 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
Ano6 T C 15: 95,949,962 probably null Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Got1l1 A G 8: 27,197,979 W341R probably damaging Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ppp2r3a G A 9: 101,153,822 T245I possibly damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rnh1 T G 7: 141,163,369 Q231P probably benign Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Uba6 C A 5: 86,127,719 C739F probably benign Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Olfr187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Olfr187 APN 16 59035906 missense probably damaging 1.00
R0218:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R1023:Olfr187 UTSW 16 59035815 missense probably benign 0.00
R1472:Olfr187 UTSW 16 59036557 missense probably damaging 1.00
R4710:Olfr187 UTSW 16 59036275 missense possibly damaging 0.94
R4738:Olfr187 UTSW 16 59036195 missense probably benign 0.00
R5265:Olfr187 UTSW 16 59036143 missense possibly damaging 0.94
R6053:Olfr187 UTSW 16 59035988 missense probably damaging 1.00
R6704:Olfr187 UTSW 16 59035862 missense probably damaging 1.00
R6854:Olfr187 UTSW 16 59036065 missense possibly damaging 0.75
R7178:Olfr187 UTSW 16 59035933 missense probably benign 0.06
R7198:Olfr187 UTSW 16 59036093 missense probably benign 0.00
R7404:Olfr187 UTSW 16 59036240 missense possibly damaging 0.81
R7462:Olfr187 UTSW 16 59036016 nonsense probably null
R7938:Olfr187 UTSW 16 59035962 nonsense probably null
R8785:Olfr187 UTSW 16 59036167 missense probably damaging 1.00
R8790:Olfr187 UTSW 16 59036217 missense possibly damaging 0.96
R8912:Olfr187 UTSW 16 59035900 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGAAATAGTGAAAACCTGGATCGAGCC -3'
(R):5'- CTTCCATAGTGGTCCCAAAGATGCTTC -3'

Sequencing Primer
(F):5'- TGGATCGAGCCAGAGAAAATAAAAAC -3'
(R):5'- GTGGTCCCAAAGATGCTTCTTAAC -3'
Posted On2013-11-18