Mutagenetix > Incidental Mutations

Incidental Mutation 'R1086:Zfp407'

85050

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

039172-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1086 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84559773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1072 (A1072T)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably benign
Transcript: ENSMUST00000125763
AA Change: A1072T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: A1072T

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182297

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.3%
20x: 94.4%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,295,061		probably benign	Het
Agbl4	G	C	4: 110,478,594		probably benign	Het
Ano6	T	C	15: 95,949,962		probably null	Het
B3gnt8	C	G	7: 25,628,311	N55K	probably damaging	Het
Brox	A	G	1: 183,282,488	Y252H	probably damaging	Het
Cfap100	T	A	6: 90,403,908	K605*	probably null	Het
Chd7	A	G	4: 8,866,458	T877A	probably benign	Het
Csmd3	T	A	15: 47,695,755	I2371F	probably damaging	Het
Cwc22	T	A	2: 77,924,480		probably benign	Het
Cyp2s1	A	T	7: 25,805,997	D347E	probably damaging	Het
Dab1	C	A	4: 104,328,572		probably benign	Het
Dis3l2	G	A	1: 86,990,149	D493N	probably benign	Het
Gm10354	T	C	5: 14,978,790	D29G	probably benign	Het
Got1l1	A	G	8: 27,197,979	W341R	probably damaging	Het
Gps2	A	G	11: 69,915,224		probably benign	Het
Haus1	A	C	18: 77,766,853		probably benign	Het
Itgam	T	C	7: 128,080,264	S193P	probably damaging	Het
Itpr2	C	A	6: 146,350,045	A1034S	probably damaging	Het
Lrp5	T	C	19: 3,649,476	R270G	probably benign	Het
Ltbr	G	A	6: 125,312,740		probably benign	Het
Mdga2	T	C	12: 66,506,102		probably benign	Het
Mug1	T	A	6: 121,885,854	M1387K	probably damaging	Het
Nwd2	C	T	5: 63,806,574	S1167L	probably damaging	Het
Olfr187	T	A	16: 59,036,263	H158L	probably damaging	Het
Pfkm	T	C	15: 98,131,665	V719A	probably benign	Het
Ppfia3	C	G	7: 45,361,758	G16A	probably damaging	Het
Ppp2r3a	G	A	9: 101,153,822	T245I	possibly damaging	Het
Ptprd	T	C	4: 76,133,258	T256A	probably damaging	Het
Ptprg	C	T	14: 11,952,706		probably benign	Het
Rabgap1	T	C	2: 37,469,446	V7A	probably damaging	Het
Rnh1	T	G	7: 141,163,369	Q231P	probably benign	Het
Rwdd2b	C	T	16: 87,436,558		probably benign	Het
Saal1	T	C	7: 46,689,459		probably benign	Het
Sap130	G	A	18: 31,650,620		probably benign	Het
Serpina1d	T	G	12: 103,763,787	M379L	probably benign	Het
Skor2	A	C	18: 76,859,299	S239R	unknown	Het
Slc16a13	A	G	11: 70,219,024	L217P	probably damaging	Het
Slc18b1	T	C	10: 23,803,795	M74T	probably benign	Het
Tacc2	A	T	7: 130,626,497	E1637D	possibly damaging	Het
Tedc2	T	A	17: 24,216,317	E366V	probably damaging	Het
Tedc2	C	A	17: 24,216,318	E366*	probably null	Het
Tg	A	C	15: 66,684,062	I868L	probably benign	Het
Ttll5	G	A	12: 85,891,079	V395I	possibly damaging	Het
Uba6	C	A	5: 86,127,719	C739F	probably benign	Het
Unc5d	A	C	8: 28,875,630	V109G	possibly damaging	Het
Zfp462	G	T	4: 55,013,000	K507N	probably damaging	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACAACTGTCACTGAATCAGGAGCAC -3'
(R):5'- TCTGGAGATGGAGAGCTTAGCAGTC -3'

Sequencing Primer
(F):5'- CAGATGACTGGTGTGGATGT -3'
(R):5'- GAGAGCTTAGCAGTCAACTCTCTG -3'

Posted On

2013-11-18