Incidental Mutation 'R1087:Nms'
ID85052
Institutional Source Beutler Lab
Gene Symbol Nms
Ensembl Gene ENSMUSG00000067604
Gene Nameneuromedin S
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38939149-38950276 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 38944111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088029] [ENSMUST00000160214]
Predicted Effect probably null
Transcript: ENSMUST00000088029
SMART Domains Protein: ENSMUSP00000085346
Gene: ENSMUSG00000067604

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160214
SMART Domains Protein: ENSMUSP00000125166
Gene: ENSMUSG00000067604

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Nms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Nms APN 1 38946111 missense possibly damaging 0.92
IGL01959:Nms APN 1 38941925 splice site probably benign
IGL02088:Nms APN 1 38939277 utr 5 prime probably benign
IGL02810:Nms APN 1 38948644 missense possibly damaging 0.94
IGL03001:Nms APN 1 38941912 missense probably benign 0.12
alacrity UTSW 1 38941895 missense probably benign 0.04
R3689:Nms UTSW 1 38946994 splice site probably benign
R4426:Nms UTSW 1 38939296 missense probably benign
R6910:Nms UTSW 1 38941895 missense probably benign 0.04
R7258:Nms UTSW 1 38946970 missense probably benign 0.01
R8848:Nms UTSW 1 38939310 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTACATGAGGAAAGCTTGACAC -3'
(R):5'- AGAGACCATTCTCTTGCTGCCCTG -3'

Sequencing Primer
(F):5'- TCTTGAAAGCCTGTGGCAAC -3'
(R):5'- CTGCCCTGAGCAGGGAG -3'
Posted On2013-11-18