Incidental Mutation 'R1087:Cnot11'
ID85053
Institutional Source Beutler Lab
Gene Symbol Cnot11
Ensembl Gene ENSMUSG00000003135
Gene NameCCR4-NOT transcription complex, subunit 11
Synonyms2410015L18Rik, D1Bwg0212e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39534992-39546889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39540058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 335 (S335T)
Ref Sequence ENSEMBL: ENSMUSP00000125638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003219] [ENSMUST00000161515] [ENSMUST00000195567]
Predicted Effect probably benign
Transcript: ENSMUST00000003219
AA Change: S335T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003219
Gene: ENSMUSG00000003135
AA Change: S335T

DomainStartEndE-ValueType
low complexity region 25 55 N/A INTRINSIC
low complexity region 62 73 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
Pfam:DUF2363 366 490 1.7e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160145
Predicted Effect probably benign
Transcript: ENSMUST00000161515
AA Change: S335T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125638
Gene: ENSMUSG00000003135
AA Change: S335T

DomainStartEndE-ValueType
low complexity region 25 55 N/A INTRINSIC
low complexity region 62 73 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
Pfam:DUF2363 366 491 3.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195567
AA Change: S9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141388
Gene: ENSMUSG00000003135
AA Change: S9T

DomainStartEndE-ValueType
Pfam:DUF2363 40 148 3.4e-44 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Cnot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02337:Cnot11 APN 1 39544883 splice site probably benign
R1398:Cnot11 UTSW 1 39545180 missense probably damaging 0.99
R3433:Cnot11 UTSW 1 39545187 splice site probably null
R4134:Cnot11 UTSW 1 39537548 missense probably benign 0.11
R4633:Cnot11 UTSW 1 39536218 missense probably benign 0.00
R5856:Cnot11 UTSW 1 39537453 missense probably benign 0.06
R6841:Cnot11 UTSW 1 39540067 nonsense probably null
R6931:Cnot11 UTSW 1 39539921 missense probably damaging 0.99
R7290:Cnot11 UTSW 1 39539939 nonsense probably null
RF007:Cnot11 UTSW 1 39542494 missense probably damaging 0.99
Z1177:Cnot11 UTSW 1 39535848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCGACCAGAGTTTATCCGCC -3'
(R):5'- AGCCTGATGCAGCAATGTAGACG -3'

Sequencing Primer
(F):5'- GAGTTTATCCGCCCACCAC -3'
(R):5'- ACTGATGCGTACCTGGAAC -3'
Posted On2013-11-18