Incidental Mutation 'R1087:Serpinb8'
ID85054
Institutional Source Beutler Lab
Gene Symbol Serpinb8
Ensembl Gene ENSMUSG00000026315
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 8
SynonymsCAP2, Spi8, CAP-2, NK10, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107590006-107610484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107606997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000108326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]
Predicted Effect probably damaging
Transcript: ENSMUST00000000514
AA Change: V266A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: V266A

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112706
AA Change: V266A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: V266A

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151283
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Axdnd1 T A 1: 156,365,689 M643L probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Serpinb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Serpinb8 APN 1 107606984 missense probably benign 0.01
IGL01309:Serpinb8 APN 1 107604718 missense probably damaging 1.00
IGL03210:Serpinb8 APN 1 107602911 missense probably damaging 1.00
Hachi UTSW 1 107597471 start codon destroyed probably null 1.00
BB002:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
BB012:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
IGL02835:Serpinb8 UTSW 1 107602856 missense probably damaging 1.00
R0284:Serpinb8 UTSW 1 107602918 critical splice donor site probably null
R1728:Serpinb8 UTSW 1 107597527 missense probably benign
R1728:Serpinb8 UTSW 1 107598954 missense probably benign
R1728:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1729:Serpinb8 UTSW 1 107597527 missense probably benign
R1729:Serpinb8 UTSW 1 107598954 missense probably benign
R1729:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1730:Serpinb8 UTSW 1 107597527 missense probably benign
R1730:Serpinb8 UTSW 1 107598954 missense probably benign
R1730:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1739:Serpinb8 UTSW 1 107597527 missense probably benign
R1739:Serpinb8 UTSW 1 107598954 missense probably benign
R1739:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1762:Serpinb8 UTSW 1 107597527 missense probably benign
R1762:Serpinb8 UTSW 1 107598954 missense probably benign
R1762:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1783:Serpinb8 UTSW 1 107597527 missense probably benign
R1783:Serpinb8 UTSW 1 107598954 missense probably benign
R1783:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1785:Serpinb8 UTSW 1 107597527 missense probably benign
R1785:Serpinb8 UTSW 1 107598954 missense probably benign
R1785:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R2120:Serpinb8 UTSW 1 107605887 missense probably damaging 1.00
R2146:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2148:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2391:Serpinb8 UTSW 1 107607069 missense probably damaging 1.00
R2897:Serpinb8 UTSW 1 107607046 missense unknown
R2898:Serpinb8 UTSW 1 107607046 missense unknown
R3114:Serpinb8 UTSW 1 107607293 missense probably benign 0.09
R3697:Serpinb8 UTSW 1 107607146 nonsense probably null
R4783:Serpinb8 UTSW 1 107604742 missense probably benign 0.05
R5225:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R5412:Serpinb8 UTSW 1 107605886 missense probably benign 0.39
R5525:Serpinb8 UTSW 1 107607293 missense probably damaging 0.99
R5554:Serpinb8 UTSW 1 107598975 missense probably benign 0.01
R5891:Serpinb8 UTSW 1 107605845 missense probably damaging 0.98
R6594:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R6681:Serpinb8 UTSW 1 107597591 missense probably damaging 1.00
R7127:Serpinb8 UTSW 1 107597470 start codon destroyed probably null 1.00
R7151:Serpinb8 UTSW 1 107605797 missense probably damaging 1.00
R7300:Serpinb8 UTSW 1 107607323 makesense probably null
R7716:Serpinb8 UTSW 1 107604708 nonsense probably null
R7807:Serpinb8 UTSW 1 107604727 missense probably damaging 1.00
R7822:Serpinb8 UTSW 1 107606993 nonsense probably null
R7925:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
R8210:Serpinb8 UTSW 1 107599006 missense probably damaging 1.00
X0018:Serpinb8 UTSW 1 107597597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGAGAGCTGTCACGGCCAAC -3'
(R):5'- GCCTTCCTCATTGACCTCCACAAAG -3'

Sequencing Primer
(F):5'- GTGTCACTAGATGAGAGCACTCC -3'
(R):5'- CACAAAGCACTTGTGGGC -3'
Posted On2013-11-18