Incidental Mutation 'R1087:Axdnd1'
ID85057
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Nameaxonemal dynein light chain domain containing 1
SynonymsLOC381304, 9430070O13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1087 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156323509-156421159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156365689 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 643 (M643L)
Ref Sequence ENSEMBL: ENSMUSP00000137354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102782] [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect probably benign
Transcript: ENSMUST00000102782
SMART Domains Protein: ENSMUSP00000099843
Gene: ENSMUSG00000078193

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 7 63 2.7e-22 PFAM
low complexity region 95 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177824
AA Change: M578L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: M578L

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: M643L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: M643L

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179572
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: M446L
Predicted Effect probably benign
Transcript: ENSMUST00000213088
AA Change: M643L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,798 S225P probably damaging Het
Anxa11 A G 14: 25,870,179 M56V unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atp8b3 T C 10: 80,520,183 R1232G probably benign Het
Bsph1 A G 7: 13,472,181 Y57C probably damaging Het
Car13 G A 3: 14,641,825 W6* probably null Het
Ccng2 T C 5: 93,273,444 I271T probably benign Het
Ces1f T A 8: 93,258,295 D468V probably damaging Het
Chil4 A G 3: 106,210,565 Y130H probably benign Het
Clns1a T A 7: 97,705,655 H69Q possibly damaging Het
Cnot11 T A 1: 39,540,058 S335T probably benign Het
Dcaf11 A G 14: 55,569,124 S461G probably damaging Het
Dlst G A 12: 85,132,639 M417I probably damaging Het
Dock4 A C 12: 40,729,938 I612L probably benign Het
Endod1 A G 9: 14,357,193 V332A possibly damaging Het
F830045P16Rik T C 2: 129,472,719 T213A possibly damaging Het
Gm5773 A T 3: 93,773,758 I246F probably damaging Het
Gml2 T A 15: 74,824,097 D113E possibly damaging Het
Grik1 T C 16: 88,006,377 E309G probably benign Het
Hectd1 A T 12: 51,776,572 I1013K probably damaging Het
Kcmf1 T C 6: 72,858,880 E22G probably damaging Het
Kdm5b T A 1: 134,600,637 C361S probably damaging Het
Kif21b T C 1: 136,162,823 S1150P probably damaging Het
Man2b1 G A 8: 85,095,171 V701M probably damaging Het
March10 T C 11: 105,390,662 R266G probably damaging Het
Milr1 A G 11: 106,755,022 Y130C probably damaging Het
Nampt A G 12: 32,833,043 T76A possibly damaging Het
Nek10 A G 14: 14,827,059 N86D possibly damaging Het
Nms T G 1: 38,944,111 probably null Het
Olfr1490 T A 19: 13,655,012 C194* probably null Het
Parp14 A G 16: 35,858,288 S437P probably damaging Het
Pif1 A G 9: 65,589,095 M226V probably benign Het
Rnf169 T C 7: 99,942,997 R216G probably benign Het
Rorb T C 19: 18,960,414 K307R probably damaging Het
Scube2 T C 7: 109,831,675 D439G probably damaging Het
Serpinb8 T C 1: 107,606,997 V266A probably damaging Het
Strip2 A G 6: 29,927,634 E226G probably damaging Het
Trim23 A G 13: 104,188,110 D212G possibly damaging Het
Vmn1r172 T A 7: 23,660,248 V186D possibly damaging Het
Vwde A T 6: 13,186,804 C895S probably damaging Het
Zswim8 C A 14: 20,717,865 probably null Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCACTGGTAATTCGTGAGAG -3'
(R):5'- GGGACAATTCCACCTTCAGATCGTC -3'

Sequencing Primer
(F):5'- CACTGGTAATTCGTGAGAGTTAACAG -3'
(R):5'- CCAAACTTGGTCATTTCTTTGGACA -3'
Posted On2013-11-18